Regulog FnrN - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Statistics of regulated genes
Genome	Genes	Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1	11	5
Loktanella vestfoldensis SKA53	10	4
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597	15	5
Oceanicola granulosus HTCC2516	1	1
Paracoccus denitrificans PD1222	14	8
Rhodobacter sphaeroides 2.4.1	20	9
Rhodobacterales bacterium HTCC2654	18	8
Roseobacter sp. MED193	17	7
Roseovarius nubinhibens ISM
Roseovarius sp. 217	19	9
Silicibacter TM1040	19	9
Silicibacter pomeroyi DSS-3	19	10
Sulfitobacter sp. EE-36	8	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
uspA	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	* Loktanella vestfoldensis SKA53 Site: position = -136 score = 5.13034 sequence = TCGTTGATGTGGATCAACCC Site: position = -114 score = 5.2607 sequence = CGTTTGACATGGATCAATGC Gene: SKA53_08751: Predicted universal stress protein UspA	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	* Oceanicola granulosus HTCC2516 Site: position = -74 score = 5.92145 sequence = GCCTTGATCTGGATCAAGGT Gene: OG2516_17525: Predicted universal stress protein UspA	* Paracoccus denitrificans PD1222 Site: position = -146 score = 5.27804 sequence = ACTTTGATCTGCGTCAATCT Gene: Pden_1849: Predicted universal stress protein UspA	* Rhodobacter sphaeroides 2.4.1 Site: position = -111 score = 5.38772 sequence = GCCTTGATCCATGTCAATGG Site: position = -79 score = 5.11642 sequence = TACTTGATCCTCATCAAGGA Gene: RSP_0697: Predicted universal stress protein UspA	* Rhodobacterales bacterium HTCC2654 Site: position = -143 score = 5.43178 sequence = ACCTTGATCCATGTCAAAAC Site: position = -100 score = 5.28189 sequence = GATTTGACACATATCAAAGC Gene: RB2654_10034: Predicted universal stress protein UspA	* Roseobacter sp. MED193 Site: position = -114 score = 5.52162 sequence = GCATTGATCTGCATCAAGAC Gene: MED193_11233: Predicted universal stress protein UspA	Roseovarius nubinhibens ISM	* Roseovarius sp. 217 Site: position = -111 score = 5.43901 sequence = TCCTTGATCTGTGTCAAAAC Site: position = -79 score = 5.40991 sequence = CGTTTGATCCGCGTCAAGGC Gene: ROS217_12221: Predicted universal stress protein UspA	* Silicibacter TM1040 Site: position = -126 score = 5.39391 sequence = ACATTGATCTGTATCAAGAT Gene: TM1040_2546: Predicted universal stress protein UspA	* Silicibacter pomeroyi DSS-3 Site: position = -98 score = 5.66391 sequence = GCTTTGATCTGCATCAAGAC Gene: SPO3527: Predicted universal stress protein UspA	Sulfitobacter sp. EE-36	Predicted universal stress protein UspA

CRON 2.
ccoN	Hyphomonas neptunium ATCC 15444 Gene: HNE_1232: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Jannaschia sp. CCS1 Site: position = -126 score = 5.62364 sequence = GGCTTGACCCAGATCAAGGT Gene: Jann_3857: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Loktanella vestfoldensis SKA53 Site: position = -105 score = 5.2607 sequence = GCATTGATCCATGTCAAACG Site: position = -83 score = 5.13034 sequence = GGGTTGATCCACATCAACGA Gene: SKA53_08741: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_08289: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Oceanicola batsensis HTCC2597 Site: position = -73 score = 4.93161 sequence = CAATTGACCCAAGTCAAAAC Gene: OB2597_20571: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	Oceanicola granulosus HTCC2516	* Paracoccus denitrificans PD1222 Site: position = -124 score = 5.27804 sequence = AGATTGACGCAGATCAAAGT Gene: Pden_1848: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Rhodobacter sphaeroides 2.4.1 Site: position = -136 score = 5.11642 sequence = TCCTTGATGAGGATCAAGTA Site: position = -104 score = 5.38772 sequence = CCATTGACATGGATCAAGGC Gene: RSP_0696: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Rhodobacterales bacterium HTCC2654 Site: position = -168 score = 5.28189 sequence = GCTTTGATATGTGTCAAATC Site: position = -125 score = 5.43178 sequence = GTTTTGACATGGATCAAGGT Gene: RB2654_10029: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Roseobacter sp. MED193 Site: position = -93 score = 5.52162 sequence = GTCTTGATGCAGATCAATGC Gene: MED193_11228: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	Roseovarius nubinhibens ISM	* Roseovarius sp. 217 Site: position = -143 score = 5.40991 sequence = GCCTTGACGCGGATCAAACG Site: position = -111 score = 5.43901 sequence = GTTTTGACACAGATCAAGGA Gene: ROS217_12226: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Silicibacter TM1040 Site: position = -117 score = 5.39391 sequence = ATCTTGATACAGATCAATGT Gene: TM1040_2545: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Silicibacter pomeroyi DSS-3 Site: position = -110 score = 5.66391 sequence = GTCTTGATGCAGATCAAAGC Gene: SPO3526: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Sulfitobacter sp. EE-36 Site: position = -72 score = 5.72861 sequence = CATTTGATCTAGATCAAGGC Gene: EE36_02238: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO	Hyphomonas neptunium ATCC 15444 Gene: HNE_1231: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Jannaschia sp. CCS1 Gene: Jann_3856: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Loktanella vestfoldensis SKA53 Gene: SKA53_08736: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_08294: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Oceanicola batsensis HTCC2597 Gene: OB2597_20576: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_1847: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0695: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Rhodobacterales bacterium HTCC2654 Gene: RB2654_10024: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Roseobacter sp. MED193 Gene: MED193_11223: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_12231: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Silicibacter TM1040 Gene: TM1040_2544: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Silicibacter pomeroyi DSS-3 Gene: SPO3525: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Sulfitobacter sp. EE-36 Gene: EE36_02233: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ	Hyphomonas neptunium ATCC 15444 Gene: HNE_1230: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Jannaschia sp. CCS1 Gene: Jann_3855: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Loktanella vestfoldensis SKA53 Gene: SKA53_08731: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_08299: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Oceanicola batsensis HTCC2597 Gene: OB2597_20581: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_1846: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0694: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Rhodobacterales bacterium HTCC2654 Gene: RB2654_10019: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Roseobacter sp. MED193 Gene: MED193_11218: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_12236: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Silicibacter TM1040 Gene: TM1040_2543: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Silicibacter pomeroyi DSS-3 Gene: SPO3524: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Sulfitobacter sp. EE-36 Gene: EE36_02228: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP	Hyphomonas neptunium ATCC 15444 Gene: HNE_1229: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Jannaschia sp. CCS1 Gene: Jann_3854: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Loktanella vestfoldensis SKA53 Gene: SKA53_08726: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_08304: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Oceanicola batsensis HTCC2597 Gene: OB2597_20586: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_1845: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0693: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Rhodobacterales bacterium HTCC2654 Gene: RB2654_10014: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Roseobacter sp. MED193 Gene: MED193_11213: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_12241: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Silicibacter TM1040 Gene: TM1040_2542: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Silicibacter pomeroyi DSS-3 Gene: SPO3523: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Sulfitobacter sp. EE-36 Gene: EE36_02223: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoG	Hyphomonas neptunium ATCC 15444 Gene: HNE_1228: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	* Jannaschia sp. CCS1 Site: position = -84 score = 5.43887 sequence = AACTTGATCCACGTCAAAGC Gene: Jann_3853: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	* Loktanella vestfoldensis SKA53 Site: position = -177 score = 5.56421 sequence = TGCTTGATCCACATCAAGGA Gene: SKA53_08641: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_08309: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	* Oceanicola batsensis HTCC2597 Site: position = -77 score = 5.70955 sequence = GCCTTGATGCAGATCAAAGG Gene: OB2597_20591: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Oceanicola granulosus HTCC2516	* Paracoccus denitrificans PD1222 Site: position = -70 score = 5.26945 sequence = CGCTTGACGCAGATCAATGC Gene: Pden_1844: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0692: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	* Rhodobacterales bacterium HTCC2654 Site: position = 0 score = 5.17218 sequence = ATGTTGATCCAAGTCAAGGC Gene: RB2654_10004: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	* Roseobacter sp. MED193 Site: position = -180 score = 5.42996 sequence = TTTTTGATCCACGTCAAAGA Gene: MED193_11193: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Roseovarius nubinhibens ISM	* Roseovarius sp. 217 Site: position = -73 score = 5.45265 sequence = AATTTGATGCAGGTCAAAGC Gene: ROS217_12261: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	* Silicibacter TM1040 Site: position = -79 score = 5.42274 sequence = TTTTTGATCCACGTCAAAGT Gene: TM1040_2540: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	* Silicibacter pomeroyi DSS-3 Site: position = -80 score = 5.4002 sequence = TTTTTGACCCATATCAAAGT Gene: SPO3522: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	* Sulfitobacter sp. EE-36 Site: position = -74 score = 5.63715 sequence = TGTTTGATGCAGATCAAAGC Gene: EE36_02218: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH	Hyphomonas neptunium ATCC 15444 Gene: HNE_1227: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Jannaschia sp. CCS1 Gene: Jann_3852: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Loktanella vestfoldensis SKA53 Gene: SKA53_08646: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_08314: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Oceanicola batsensis HTCC2597 Gene: OB2597_20596: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_1843: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0691: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Rhodobacterales bacterium HTCC2654 Gene: RB2654_09999: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Roseobacter sp. MED193 Gene: MED193_11188: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_12266: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Silicibacter TM1040 Gene: TM1040_2539: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Silicibacter pomeroyi DSS-3 Gene: SPO3521: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Sulfitobacter sp. EE-36 Gene: EE36_02213: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI	Hyphomonas neptunium ATCC 15444 Gene: HNE_1226: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Jannaschia sp. CCS1 Gene: Jann_3851: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Loktanella vestfoldensis SKA53 Gene: SKA53_08651: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_08319: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Oceanicola batsensis HTCC2597 Gene: OB2597_20601: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_1842: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0690: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Rhodobacterales bacterium HTCC2654 Gene: RB2654_09994: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Roseobacter sp. MED193 Gene: MED193_11183: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_12271: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Silicibacter TM1040 Gene: TM1040_2538: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Silicibacter pomeroyi DSS-3 Gene: SPO3520: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Sulfitobacter sp. EE-36 Gene: EE36_02208: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS	Hyphomonas neptunium ATCC 15444 Gene: HNE_1225: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Jannaschia sp. CCS1 Gene: Jann_3850: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Loktanella vestfoldensis SKA53 Gene: SKA53_08656: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_08324: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Oceanicola batsensis HTCC2597 Gene: OB2597_20606: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_1841: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0689: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Rhodobacterales bacterium HTCC2654 Gene: RB2654_09989: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Roseobacter sp. MED193 Gene: MED193_11178: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_12276: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Silicibacter TM1040 Gene: TM1040_2537: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Silicibacter pomeroyi DSS-3 Gene: SPO3519: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Sulfitobacter sp. EE-36 Gene: EE36_02203: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

CRON 3.
ctaD	Hyphomonas neptunium ATCC 15444 Gene: HNE_1039: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Jannaschia sp. CCS1 Gene: Jann_1250: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Loktanella vestfoldensis SKA53 Gene: SKA53_06992: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_13995: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	* Oceanicola batsensis HTCC2597 Site: position = -113 score = 5.17196 sequence = TATTTGATCTGCGTCAATAC Gene: OB2597_06915: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Oceanicola granulosus HTCC2516 Gene: OG2516_07320: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	2 Paracoccus denitrificans PD1222 Gene: Pden_1938: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Gene: Pden_3028: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	* Rhodobacter sphaeroides 2.4.1 Site: position = -127 score = 5.61574 sequence = TTATTGATCCAGATCAAAGT Gene: RSP_1877: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	* Rhodobacterales bacterium HTCC2654 Site: position = -212 score = 5.59745 sequence = TCCTTGACCCGGATCAAACA Gene: RB2654_08222: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	* Roseobacter sp. MED193 Site: position = -122 score = 5.59622 sequence = ATCTTGATCCAGATCAAACT Gene: MED193_08728: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Roseovarius nubinhibens ISM Gene: ISM_04945: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	* Roseovarius sp. 217 Site: position = -128 score = 5.422 sequence = TCTTTGATCTGCATCAATTT Gene: ROS217_15111: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	* Silicibacter TM1040 Site: position = -125 score = 5.60344 sequence = TTCTTGATCCAGATCAAACT Gene: TM1040_2291: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	* Silicibacter pomeroyi DSS-3 Site: position = -120 score = 5.59622 sequence = ATCTTGATCCAGATCAAACT Gene: SPO1383: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Sulfitobacter sp. EE-36 Gene: EE36_17347: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Cytochrome c oxidase polypeptide I (EC 1.9.3.1)

CRON 4.
ctaC	Hyphomonas neptunium ATCC 15444 Gene: HNE_1038: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Jannaschia sp. CCS1 Gene: Jann_3155: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Loktanella vestfoldensis SKA53 Gene: SKA53_08421: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_13990: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Oceanicola batsensis HTCC2597 Site: position = -189 score = 5.60585 sequence = TTCTTGATCCAGATCAAAAA Gene: OB2597_15845: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_4321: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Rhodobacter sphaeroides 2.4.1 Site: position = -161 score = 5.47438 sequence = TCCTTGATTCAGATCAAATG Gene: RSP_1826: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Rhodobacterales bacterium HTCC2654 Site: position = -192 score = 5.29795 sequence = GCATTGATCTGCATCAATCG Gene: RB2654_06514: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Roseobacter sp. MED193 Site: position = -178 score = 5.40066 sequence = TTTTTGATCTAAATCAAGAA Gene: MED193_08963: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Roseovarius nubinhibens ISM Gene: ISM_03125: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Roseovarius sp. 217 Site: position = -219 score = 5.18475 sequence = AATTTGATTTAAATCAAAAA Gene: ROS217_04445: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Silicibacter TM1040 Site: position = -164 score = 5.24366 sequence = TTTTTGATCTAAGTCAAGAA Gene: TM1040_2336: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Silicibacter pomeroyi DSS-3 Site: position = -162 score = 5.62445 sequence = TGTTTGATCCAGATCAAAAA Gene: SPO3076: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Sulfitobacter sp. EE-36 Gene: EE36_09905: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
ctaB	Hyphomonas neptunium ATCC 15444 Gene: HNE_1040: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Jannaschia sp. CCS1 Gene: Jann_3154: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Loktanella vestfoldensis SKA53 Gene: SKA53_08416: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_14006: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Oceanicola batsensis HTCC2597 Gene: OB2597_15850: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_4320: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Rhodobacter sphaeroides 2.4.1 Gene: RSP_1827: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06509: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Roseobacter sp. MED193 Gene: MED193_08958: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Roseovarius nubinhibens ISM Gene: ISM_03120: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Roseovarius sp. 217 Gene: ROS217_04440: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Silicibacter TM1040 Gene: TM1040_2335: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Silicibacter pomeroyi DSS-3 Gene: SPO3075: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Sulfitobacter sp. EE-36 Gene: EE36_09910: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
ctaX	Hyphomonas neptunium ATCC 15444 Gene: HNE_1041: Hypothetical protein in cta gene cluster	Jannaschia sp. CCS1 Gene: Jann_3153: Hypothetical protein in cta gene cluster	Loktanella vestfoldensis SKA53 Gene: SKA53_08411: Hypothetical protein in cta gene cluster	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_14011: Hypothetical protein in cta gene cluster	Oceanicola batsensis HTCC2597 Gene: OB2597_15855: Hypothetical protein in cta gene cluster	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_4319: Hypothetical protein in cta gene cluster	Rhodobacter sphaeroides 2.4.1 Gene: RSP_6021: Hypothetical protein in cta gene cluster	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06504: Hypothetical protein in cta gene cluster	Roseobacter sp. MED193 Gene: MED193_08953: Hypothetical protein in cta gene cluster	Roseovarius nubinhibens ISM Gene: ISM_03115: Hypothetical protein in cta gene cluster	Roseovarius sp. 217 Gene: ROS217_04435: Hypothetical protein in cta gene cluster	Silicibacter TM1040 Gene: TM1040_2334: Hypothetical protein in cta gene cluster	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36 Gene: EE36_09915: Hypothetical protein in cta gene cluster	Hypothetical protein in cta gene cluster
ctaG	Hyphomonas neptunium ATCC 15444 Gene: HNE_1042: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Jannaschia sp. CCS1 Gene: Jann_3152: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Loktanella vestfoldensis SKA53 Gene: SKA53_08406: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_14016: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Oceanicola batsensis HTCC2597 Gene: OB2597_15860: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_4318: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Rhodobacter sphaeroides 2.4.1 Gene: RSP_1828: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06499: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Roseobacter sp. MED193 Gene: MED193_08948: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Roseovarius nubinhibens ISM Gene: ISM_03110: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Roseovarius sp. 217 Gene: ROS217_04430: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Silicibacter TM1040 Gene: TM1040_2333: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Silicibacter pomeroyi DSS-3 Gene: SPO3074: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Sulfitobacter sp. EE-36 Gene: EE36_09920: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
ctaE	Hyphomonas neptunium ATCC 15444 Gene: HNE_1043: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Jannaschia sp. CCS1 Gene: Jann_3151: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Loktanella vestfoldensis SKA53 Gene: SKA53_08401: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_14021: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Oceanicola batsensis HTCC2597 Gene: OB2597_15865: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222 Gene: Pden_4317: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Rhodobacter sphaeroides 2.4.1 Gene: RSP_1829: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06494: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Roseobacter sp. MED193 Gene: MED193_08943: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Roseovarius nubinhibens ISM Gene: ISM_03105: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Roseovarius sp. 217 Gene: ROS217_04425: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Silicibacter TM1040 Gene: TM1040_2332: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Silicibacter pomeroyi DSS-3 Gene: SPO3073: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Sulfitobacter sp. EE-36 Gene: EE36_09925: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

CRON 5.
fnrN	Hyphomonas neptunium ATCC 15444	* Jannaschia sp. CCS1 Site: position = -56 score = 5.39772 sequence = GCATTGATTTGGATCAAGCG Gene: Jann_3858: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	Loktanella vestfoldensis SKA53 Gene: SKA53_08756: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516 Gene: OG2516_17530: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	* Paracoccus denitrificans PD1222 Site: position = -131 score = 5.31016 sequence = ACCTTGACCCAAATCAAATG Gene: Pden_1850: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	* Rhodobacter sphaeroides 2.4.1 Site: position = -31 score = 5.54002 sequence = GCTTTGATTCAGATCAAGCG Gene: RSP_0698: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	* Rhodobacterales bacterium HTCC2654 Site: position = -29 score = 5.34302 sequence = ACATTGATACGGATCAAATG Gene: RB2654_10044: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	* Roseobacter sp. MED193 Site: position = -29 score = 5.34421 sequence = ACTTTGACTTGGATCAAACG Gene: MED193_11238: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	Roseovarius nubinhibens ISM	* Roseovarius sp. 217 Site: position = -53 score = 5.30224 sequence = GCTTTGATTTAGATCAACCG Gene: ROS217_12216: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	* Silicibacter TM1040 Site: position = -29 score = 5.20421 sequence = GCTTTGACACAGATCAACCA Gene: TM1040_2547: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	* Silicibacter pomeroyi DSS-3 Site: position = -32 score = 5.35098 sequence = ACCTTGACTCAGATCAAGTA Gene: SPO3531: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	Sulfitobacter sp. EE-36 Gene: EE36_11304: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family

CRON 6.
hemA	Hyphomonas neptunium ATCC 15444 Gene: HNE_2062: 5-aminolevulinate synthase (EC 2.3.1.37)	* Jannaschia sp. CCS1 Site: position = -67 score = 5.90163 sequence = CCTTTGATCCAGATCAAAGC Gene: Jann_1933: 5-aminolevulinate synthase (EC 2.3.1.37)	* Loktanella vestfoldensis SKA53 Site: position = -167 score = 4.92982 sequence = TTATTGATCCAGATCATGGT Gene: SKA53_02751: 5-aminolevulinate synthase (EC 2.3.1.37)	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_01936: 5-aminolevulinate synthase (EC 2.3.1.37)	* Oceanicola batsensis HTCC2597 Site: position = -155 score = 5.25378 sequence = GAATTGATTCACATCAAGGA Gene: OB2597_01932: 5-aminolevulinate synthase (EC 2.3.1.37)	Oceanicola granulosus HTCC2516 Gene: OG2516_03560: 5-aminolevulinate synthase (EC 2.3.1.37)	* Paracoccus denitrificans PD1222 Site: position = -40 score = 5.39969 sequence = GGCTTGATGCGTATCAAGGT Gene: Pden_1822: 5-aminolevulinate synthase (EC 2.3.1.37)	* Rhodobacter sphaeroides 2.4.1 Site: position = -87 score = 5.19841 sequence = GATTTGATCCTTATCAAGGC Gene: RSP_2984: 5-aminolevulinate synthase (EC 2.3.1.37)	* Rhodobacterales bacterium HTCC2654 Site: position = -127 score = 5.27211 sequence = GGTTTGATCCACGTCAACGC Gene: RB2654_03389: 5-aminolevulinate synthase (EC 2.3.1.37)	* Roseobacter sp. MED193 Site: position = -162 score = 5.38476 sequence = TATTTGACCTGTATCAAAGT Gene: MED193_21064: 5-aminolevulinate synthase (EC 2.3.1.37)	Roseovarius nubinhibens ISM Gene: ISM_15170: 5-aminolevulinate synthase (EC 2.3.1.37)	* Roseovarius sp. 217 Site: position = -168 score = 5.24657 sequence = GACTTGACCCAAGTCAAGGA Gene: ROS217_21737: 5-aminolevulinate synthase (EC 2.3.1.37)	* Silicibacter TM1040 Site: position = -169 score = 5.37819 sequence = TATTTGACCTGTATCAAGGA Gene: TM1040_0860: 5-aminolevulinate synthase (EC 2.3.1.37)	* Silicibacter pomeroyi DSS-3 Site: position = -146 score = 5.11806 sequence = TAATTGACCCAAGTCAAGGC Gene: SPO2596: 5-aminolevulinate synthase (EC 2.3.1.37)	Sulfitobacter sp. EE-36 Gene: EE36_14417: 5-aminolevulinate synthase (EC 2.3.1.37)	5-aminolevulinate synthase (EC 2.3.1.37)

CRON 7.
hemN	Hyphomonas neptunium ATCC 15444	* Jannaschia sp. CCS1 Site: position = -51 score = 5.39772 sequence = CGCTTGATCCAAATCAATGC Gene: Jann_3859: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	* Paracoccus denitrificans PD1222 Site: position = -51 score = 5.31016 sequence = CATTTGATTTGGGTCAAGGT Gene: Pden_1851: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	* Rhodobacter sphaeroides 2.4.1 Site: position = -51 score = 5.54002 sequence = CGCTTGATCTGAATCAAAGC Gene: RSP_0699: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	* Rhodobacterales bacterium HTCC2654 Site: position = -52 score = 5.34302 sequence = CATTTGATCCGTATCAATGT Gene: RB2654_10049: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	Roseobacter sp. MED193 Gene: MED193_11243: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	Roseovarius nubinhibens ISM	* Roseovarius sp. 217 Site: position = -51 score = 5.30224 sequence = CGGTTGATCTAAATCAAAGC Gene: ROS217_12211: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	* Silicibacter TM1040 Site: position = -51 score = 5.20421 sequence = TGGTTGATCTGTGTCAAAGC Gene: TM1040_2548: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	* Silicibacter pomeroyi DSS-3 Site: position = -52 score = 5.35098 sequence = TACTTGATCTGAGTCAAGGT Gene: SPO3532: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	Sulfitobacter sp. EE-36	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)

CRON 8.
ompW	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	* Paracoccus denitrificans PD1222 Site: position = -51 score = 5.48362 sequence = ATCTTGATCCAGATCAACGT Gene: Pden_3636: Outer membrane protein W precursor	* Rhodobacter sphaeroides 2.4.1 Site: position = -69 score = 5.41025 sequence = CCATTGACGCAGATCAAGGC Gene: RSP_2507: Outer membrane protein W precursor	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	* Roseovarius sp. 217 Site: position = -75 score = 5.21525 sequence = AACTTGACCCAAATCAATGT Gene: ROS217_20807: Outer membrane protein W precursor	* Silicibacter TM1040 Site: position = -78 score = 5.21265 sequence = CATTTGATCTAGATCAGAGC Gene: TM1040_0734: Outer membrane protein W precursor	* Silicibacter pomeroyi DSS-3 Site: position = -75 score = 5.20071 sequence = ATCTTGATCCAGATCAGGGA Gene: SPO2792: Outer membrane protein W precursor	Sulfitobacter sp. EE-36	Outer membrane protein W precursor

CRON 9.
ccpR	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	* Paracoccus denitrificans PD1222 Site: position = -141 score = 5.05381 sequence = CATCTGACCCAGATCAAAGC Gene: Pden_0893: Cytochrome c551 peroxidase (EC 1.11.1.5)	* Rhodobacter sphaeroides 2.4.1 Site: position = -81 score = 5.23608 sequence = GAATTGATCTAAGTCAAAGG Gene: RSP_2395: Cytochrome c551 peroxidase (EC 1.11.1.5)	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_11501: Cytochrome c551 peroxidase (EC 1.11.1.5)	Silicibacter TM1040	* Silicibacter pomeroyi DSS-3 Site: position = -96 score = 5.49363 sequence = CGCTTGATCCATATCAAAGT Gene: SPO0330: Cytochrome c551 peroxidase (EC 1.11.1.5)	Sulfitobacter sp. EE-36	Cytochrome c551 peroxidase (EC 1.11.1.5)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog FnrN - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --