Regulon of FnrN in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_3858
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 5.9 Sequence: CCTTTGATCCAGATCAAAGC Locus tag: Jann_1933 Name: hemA Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
	Jann_1933	hemA	5-aminolevulinate synthase (EC 2.3.1.37)
Position: -84 Score: 5.4 Sequence: AACTTGATCCACGTCAAAGC Locus tag: Jann_3853 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Jann_3852 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Jann_3851 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Jann_3850 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	Jann_3853	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	Jann_3852	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	Jann_3851	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	Jann_3850	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Position: -126 Score: 5.6 Sequence: GGCTTGACCCAGATCAAGGT Locus tag: Jann_3857 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Jann_3856 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Jann_3855 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Jann_3854 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	Jann_3857	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	Jann_3856	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	Jann_3855	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	Jann_3854	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Position: -51 Score: 5.4 Sequence: CGCTTGATCCAAATCAATGC Locus tag: Jann_3859 Name: hemN Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
	Jann_3859	hemN	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
Position: -56 Score: 5.4 Sequence: GCATTGATTTGGATCAAGCG Locus tag: Jann_3858 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	Jann_3858	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD