Regulon of FnrN in Loktanella vestfoldensis SKA53

Properties
Regulator type:	Transcription factor
TF locus tag:	SKA53_08756
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -136 Score: 5.1 Sequence: TCGTTGATGTGGATCAACCC Position: -114 Score: 5.3 Sequence: CGTTTGACATGGATCAATGC Locus tag: SKA53_08751 Name: uspA Funciton: Predicted universal stress protein UspA
	SKA53_08751	uspA	Predicted universal stress protein UspA
Position: -167 Score: 4.9 Sequence: TTATTGATCCAGATCATGGT Locus tag: SKA53_02751 Name: hemA Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
	SKA53_02751	hemA	5-aminolevulinate synthase (EC 2.3.1.37)
Position: -177 Score: 5.6 Sequence: TGCTTGATCCACATCAAGGA Locus tag: SKA53_08641 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: SKA53_08646 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: SKA53_08651 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: SKA53_08656 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	SKA53_08641	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	SKA53_08646	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	SKA53_08651	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	SKA53_08656	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Position: -105 Score: 5.3 Sequence: GCATTGATCCATGTCAAACG Position: -83 Score: 5.1 Sequence: GGGTTGATCCACATCAACGA Locus tag: SKA53_08741 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: SKA53_08736 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: SKA53_08731 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: SKA53_08726 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	SKA53_08741	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	SKA53_08736	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	SKA53_08731	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	SKA53_08726	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD