Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ctaE gene

Properties
Regulog: FnrN - Rhodobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 85 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanicola batsensis HTCC2597
Position: -189
Score: 5.60585
Sequence: TTCTTGATCCAGATCAAAAA
Locus tag: OB2597_15845
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: OB2597_15850
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: OB2597_15855
Name: ctaX
Funciton: Hypothetical protein in cta gene cluster
Locus tag: OB2597_15860
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: OB2597_15865
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaB-ctaX-ctaG-ctaE -189 5.6 TTCTTGATCCAGATCAAAAA OB2597_15845
Rhodobacter sphaeroides 2.4.1
Position: -161
Score: 5.47438
Sequence: TCCTTGATTCAGATCAAATG
Locus tag: RSP_1826
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: RSP_1827
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: RSP_6021
Name: ctaX
Funciton: Hypothetical protein in cta gene cluster
Locus tag: RSP_1828
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: RSP_1829
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaB-ctaX-ctaG-ctaE -161 5.5 TCCTTGATTCAGATCAAATG RSP_1826
Rhodobacterales bacterium HTCC2654
Position: -192
Score: 5.29795
Sequence: GCATTGATCTGCATCAATCG
Locus tag: RB2654_06514
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: RB2654_06509
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: RB2654_06504
Name: ctaX
Funciton: Hypothetical protein in cta gene cluster
Locus tag: RB2654_06499
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: RB2654_06494
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaB-ctaX-ctaG-ctaE -192 5.3 GCATTGATCTGCATCAATCG RB2654_06514
Roseobacter sp. MED193
Position: -178
Score: 5.40066
Sequence: TTTTTGATCTAAATCAAGAA
Locus tag: MED193_08963
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: MED193_08958
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: MED193_08953
Name: ctaX
Funciton: Hypothetical protein in cta gene cluster
Locus tag: MED193_08948
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: MED193_08943
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaB-ctaX-ctaG-ctaE -178 5.4 TTTTTGATCTAAATCAAGAA MED193_08963
Roseovarius sp. 217
Position: -219
Score: 5.18475
Sequence: AATTTGATTTAAATCAAAAA
Locus tag: ROS217_04445
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: ROS217_04440
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: ROS217_04435
Name: ctaX
Funciton: Hypothetical protein in cta gene cluster
Locus tag: ROS217_04430
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: ROS217_04425
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaB-ctaX-ctaG-ctaE -219 5.2 AATTTGATTTAAATCAAAAA ROS217_04445
Silicibacter TM1040
Position: -164
Score: 5.24366
Sequence: TTTTTGATCTAAGTCAAGAA
Locus tag: TM1040_2336
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: TM1040_2335
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: TM1040_2334
Name: ctaX
Funciton: Hypothetical protein in cta gene cluster
Locus tag: TM1040_2333
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: TM1040_2332
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaB-ctaX-ctaG-ctaE -164 5.2 TTTTTGATCTAAGTCAAGAA TM1040_2336
Silicibacter pomeroyi DSS-3
Position: -162
Score: 5.62445
Sequence: TGTTTGATCCAGATCAAAAA
Locus tag: SPO3076
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: SPO3075
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: SPO3074
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: SPO3073
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaB-ctaG-ctaE -162 5.6 TGTTTGATCCAGATCAAAAA SPO3076
© 2009-2020 RegPrecise