Regulon of FnrN in Oceanicola granulosus HTCC2516
| Regulator type: | Transcription factor |
| TF locus tag: | OG2516_17530 |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Regulog: | FnrN - Rhodobacterales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By trascription factor - FnrN/FixK
- By TF family - CRP
- By effector - Oxygen
- By pathway - Oxidative stress response
- By pathway - Nitrogen fixation
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -74
Score: 5.9 Sequence: GCCTTGATCTGGATCAAGGT
Locus tag: OG2516_17525
Name: uspA Funciton: Predicted universal stress protein UspA |
|||
|
uspA
|
Predicted universal stress protein UspA
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |