Regulon of FnrN in Oceanicola granulosus HTCC2516

Properties
Regulator type:	Transcription factor
TF locus tag:	OG2516_17530
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 5.9 Sequence: GCCTTGATCTGGATCAAGGT Locus tag: OG2516_17525 Name: uspA Funciton: Predicted universal stress protein UspA
	OG2516_17525	uspA	Predicted universal stress protein UspA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD