Regulon of FnrN in Roseovarius sp. 217

Properties
Regulator type:	Transcription factor
TF locus tag:	ROS217_12216
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes	19
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -111 Score: 5.4 Sequence: TCCTTGATCTGTGTCAAAAC Position: -79 Score: 5.4 Sequence: CGTTTGATCCGCGTCAAGGC Locus tag: ROS217_12221 Name: uspA Funciton: Predicted universal stress protein UspA
	ROS217_12221	uspA	Predicted universal stress protein UspA
Position: -53 Score: 5.3 Sequence: GCTTTGATTTAGATCAACCG Locus tag: ROS217_12216 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	ROS217_12216	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -168 Score: 5.2 Sequence: GACTTGACCCAAGTCAAGGA Locus tag: ROS217_21737 Name: hemA Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
	ROS217_21737	hemA	5-aminolevulinate synthase (EC 2.3.1.37)
Position: -73 Score: 5.5 Sequence: AATTTGATGCAGGTCAAAGC Locus tag: ROS217_12261 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: ROS217_12266 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: ROS217_12271 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: ROS217_12276 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	ROS217_12261	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	ROS217_12266	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	ROS217_12271	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	ROS217_12276	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Position: -143 Score: 5.4 Sequence: GCCTTGACGCGGATCAAACG Position: -111 Score: 5.4 Sequence: GTTTTGACACAGATCAAGGA Locus tag: ROS217_12226 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: ROS217_12231 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: ROS217_12236 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: ROS217_12241 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	ROS217_12226	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	ROS217_12231	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	ROS217_12236	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	ROS217_12241	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Position: -75 Score: 5.2 Sequence: AACTTGACCCAAATCAATGT Locus tag: ROS217_20807 Name: ompW Funciton: Outer membrane protein W precursor
	ROS217_20807	ompW	Outer membrane protein W precursor
Position: -51 Score: 5.3 Sequence: CGGTTGATCTAAATCAAAGC Locus tag: ROS217_12211 Name: hemN Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
	ROS217_12211	hemN	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
Position: -128 Score: 5.4 Sequence: TCTTTGATCTGCATCAATTT Locus tag: ROS217_15111 Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
	ROS217_15111	ctaD	Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Position: -219 Score: 5.2 Sequence: AATTTGATTTAAATCAAAAA Locus tag: ROS217_04445 Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: ROS217_04440 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: ROS217_04435 Name: ctaX Funciton: Hypothetical protein in cta gene cluster Locus tag: ROS217_04430 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: ROS217_04425 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
	ROS217_04445	ctaC	Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
	ROS217_04440	ctaB	Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
	ROS217_04435	ctaX	Hypothetical protein in cta gene cluster
	ROS217_04430	ctaG	Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
	ROS217_04425	ctaE	Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of FnrN in Roseovarius sp. 217

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --