Regulon of FnrN in Paracoccus denitrificans PD1222

Properties
Regulator type:	Transcription factor
TF locus tag:	Pden_1850
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes	14
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -146 Score: 5.3 Sequence: ACTTTGATCTGCGTCAATCT Locus tag: Pden_1849 Name: uspA Funciton: Predicted universal stress protein UspA
	Pden_1849	uspA	Predicted universal stress protein UspA
Position: -131 Score: 5.3 Sequence: ACCTTGACCCAAATCAAATG Locus tag: Pden_1850 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	Pden_1850	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -40 Score: 5.4 Sequence: GGCTTGATGCGTATCAAGGT Locus tag: Pden_1822 Name: hemA Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
	Pden_1822	hemA	5-aminolevulinate synthase (EC 2.3.1.37)
Position: -70 Score: 5.3 Sequence: CGCTTGACGCAGATCAATGC Locus tag: Pden_1844 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Pden_1843 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Pden_1842 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Pden_1841 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	Pden_1844	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	Pden_1843	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	Pden_1842	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	Pden_1841	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Position: -124 Score: 5.3 Sequence: AGATTGACGCAGATCAAAGT Locus tag: Pden_1848 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Pden_1847 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Pden_1846 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Pden_1845 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	Pden_1848	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	Pden_1847	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	Pden_1846	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	Pden_1845	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Position: -141 Score: 5.1 Sequence: CATCTGACCCAGATCAAAGC Locus tag: Pden_0893 Name: ccpR Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
	Pden_0893	ccpR	Cytochrome c551 peroxidase (EC 1.11.1.5)
Position: -51 Score: 5.5 Sequence: ATCTTGATCCAGATCAACGT Locus tag: Pden_3636 Name: ompW Funciton: Outer membrane protein W precursor
	Pden_3636	ompW	Outer membrane protein W precursor
Position: -51 Score: 5.3 Sequence: CATTTGATTTGGGTCAAGGT Locus tag: Pden_1851 Name: hemN Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
	Pden_1851	hemN	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of FnrN in Paracoccus denitrificans PD1222

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --