Regulog CblR - Halobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | |
| Regulation mode: | |
| Biological process: | Cobalamin biosynthesis |
| Effector: | |
| Phylum: | Euryarchaeota |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Halobacteriales
- By trascription factor - CblR
- By pathway - Cobalamin biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Haloarcula marismortui ATCC 43049 | 12 | 7 |
| Halobacterium salinarum R1 | 32 | 7 |
| Halobacterium sp. NRC-1 | 32 | 7 |
| Haloferax volcanii DS2 | 13 | 3 |
| Halomicrobium mukohataei DSM 12286 | 31 | 10 |
| Haloquadratum walsbyi DSM 16790 | 23 | 8 |
| Halorhabdus utahensis DSM 12940 | 13 | 3 |
| Halorubrum lacusprofundi ATCC 49239 | 24 | 9 |
| Haloterrigena turkmenica DSM 5511 | 13 | 7 |
| Natrialba magadii ATCC 43099 | 8 | 5 |
| Natronomonas pharaonis DSM 2160 | 27 | 9 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| cbiT |
*
Haloarcula marismortui ATCC 43049 Site: position = -46 score = 5.7005 sequence = AATACAACCAAAATTGTTTT Gene: rrnAC2998: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
*
Halobacterium salinarum R1 Site: position = -45 score = 5.63854 sequence = AATACAATCAAAATTGTTTT Gene: OE3207F: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
*
Halobacterium sp. NRC-1 Site: position = -45 score = 5.63854 sequence = AATACAATCAAAATTGTTTT Gene: VNG1550G: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
*
Haloferax volcanii DS2 Site: position = -123 score = 5.10688 sequence = AGAACAAGCGAGATTGTGTT Site: position = -150 score = 5.04933 sequence = AAACCAAGCACAGTTGTAAA Site: position = -47 score = 5.43003 sequence = ACAACAAGCACAATTGTTTT Gene: HVO_B0062: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
*
Halomicrobium mukohataei DSM 12286 Site: position = -46 score = 5.69222 sequence = AAAACAACCAAAATTGTTTT Gene: Hmuk_1874: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
*
Haloquadratum walsbyi DSM 16790 Site: position = -47 score = 5.3072 sequence = AGAGCAAGCGTAATTGTTTT Site: position = -113 score = 5.53781 sequence = AAAACAATTTTGCTTGTACT Gene: HQ1834A: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
|
*
Halorubrum lacusprofundi ATCC 49239 Site: position = -46 score = 5.04216 sequence = AGCTCAACCAAAATTGTTTT Gene: Hlac_3478: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
*
Haloterrigena turkmenica DSM 5511 Site: position = -46 score = 4.94547 sequence = ATACCAAACAAAATTGTTTT Site: position = -66 score = 4.38438 sequence = TGAGCAAGCGAACTTGCCTT Gene: Htur_0996: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
|
*
Natronomonas pharaonis DSM 2160 Site: position = -46 score = 5.29007 sequence = AGCACAACCAAAATTGTTTT Gene: NP1124A: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
| cbiL |
Gene: rrnAC3000: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
Gene: OE3209F: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
Gene: VNG1551G: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
Gene: HVO_B0061: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
Gene: Hmuk_1873: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
Gene: HQ1833A: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
|
Gene: Hlac_3477: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
Gene: Htur_0995: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
|
Gene: NP1122A: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
| cbiF |
Gene: rrnAC3001: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
Gene: OE3212F: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
Gene: VNG1553G: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
Gene: HVO_B0060: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
Gene: Hmuk_1872: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
Gene: HQ1832A: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
|
Gene: Hlac_3476: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
Gene: Htur_0994: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
|
Gene: NP1120A: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
| cbiG |
Gene: rrnAC3003: Cobalamin biosynthesis protein CbiG |
Gene: OE3213F: Cobalamin biosynthesis protein CbiG |
Gene: VNG1554G: Cobalamin biosynthesis protein CbiG |
Gene: HVO_B0059: Cobalamin biosynthesis protein CbiG |
Gene: Hmuk_1871: Cobalamin biosynthesis protein CbiG |
*2
Haloquadratum walsbyi DSM 16790 Gene: HQ1831A: Cobalamin biosynthesis protein CbiG Site: position = -107 score = 5.31393 sequence = AAGACAACCGTAATTGTTTT Gene: HQ3035A: Cobalamin biosynthesis protein CbiG |
|
Gene: Hlac_3475: Cobalamin biosynthesis protein CbiG |
Gene: Htur_0993: Cobalamin biosynthesis protein CbiG |
|
Gene: NP1118A: Cobalamin biosynthesis protein CbiG |
Cobalamin biosynthesis protein CbiG |
| cbiH |
*2
Haloarcula marismortui ATCC 43049 Site: position = -20 score = 5.53781 sequence = AGTACAAGCACAATTGTTTT Gene: rrnAC3005: Cobalt-precorrin-3b C17-methyltransferase Gene: rrnAC3008: Cobalt-precorrin-3b C17-methyltransferase |
2
Halobacterium salinarum R1 Gene: OE3214F: Cobalt-precorrin-3b C17-methyltransferase Gene: OE3216F: Cobalt-precorrin-3b C17-methyltransferase |
2
Halobacterium sp. NRC-1 Gene: VNG1555G: Cobalt-precorrin-3b C17-methyltransferase Gene: VNG1557G: Cobalt-precorrin-3b C17-methyltransferase |
2
Haloferax volcanii DS2 Gene: HVO_B0057: Cobalt-precorrin-3b C17-methyltransferase Gene: HVO_B0058: Cobalt-precorrin-3b C17-methyltransferase |
2
Halomicrobium mukohataei DSM 12286 Gene: Hmuk_1869: Cobalt-precorrin-3b C17-methyltransferase Gene: Hmuk_1870: Cobalt-precorrin-3b C17-methyltransferase |
2
Haloquadratum walsbyi DSM 16790 Gene: HQ3034A: Cobalt-precorrin-3b C17-methyltransferase Gene: HQ3033A: Cobalt-precorrin-3b C17-methyltransferase |
|
2
Halorubrum lacusprofundi ATCC 49239 Gene: Hlac_3473: Cobalt-precorrin-3b C17-methyltransferase Gene: Hlac_3474: Cobalt-precorrin-3b C17-methyltransferase |
2
Haloterrigena turkmenica DSM 5511 Gene: Htur_0992: Cobalt-precorrin-3b C17-methyltransferase Gene: Htur_0991: Cobalt-precorrin-3b C17-methyltransferase |
|
*2
Natronomonas pharaonis DSM 2160 Gene: NP1114A: Cobalt-precorrin-3b C17-methyltransferase Site: position = -101 score = 5.23884 sequence = ACAACAAGCACAATTGTTAT Gene: NP1116A: Cobalt-precorrin-3b C17-methyltransferase |
Cobalt-precorrin-3b C17-methyltransferase |
| VNG1558H |
Gene: rrnAC3009: conserved cobalamin operon protein |
Gene: OE3219F: conserved cobalamin operon protein |
Gene: VNG1558H: conserved cobalamin operon protein |
Gene: HVO_B0056: conserved cobalamin operon protein |
Gene: Hmuk_1868: conserved cobalamin operon protein |
Gene: HQ1830A: conserved cobalamin operon protein |
|
Gene: Hlac_3472: conserved cobalamin operon protein |
Gene: Htur_0990: conserved cobalamin operon protein |
|
Gene: NP1112A: conserved cobalamin operon protein |
conserved cobalamin operon protein |
| VNG1559H |
Gene: rrnAC3010: conserved cobalamin operon protein |
Gene: OE3218F: conserved cobalamin operon protein |
Gene: VNG1559H: conserved cobalamin operon protein |
Gene: HVO_B0055: conserved cobalamin operon protein |
Gene: Hmuk_1867: conserved cobalamin operon protein |
Gene: HQ3032B: conserved cobalamin operon protein |
|
Gene: Hlac_3471: conserved cobalamin operon protein |
Gene: Htur_0989: conserved cobalamin operon protein |
|
Gene: NP1110A: conserved cobalamin operon protein |
conserved cobalamin operon protein |
| cbiK |
Gene: rrnAC3011: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis |
Gene: OE3221F: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis |
Gene: VNG1561Cm: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis |
Gene: HVO_B0054: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis |
Gene: Hmuk_1866: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis |
Gene: HQ3032A: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis |
|
Gene: Hlac_3470: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis |
Gene: Htur_0988: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis |
|
Gene: NP1108A: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis |
Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis |
| VNG1562H |
Gene: rrnAC3012: conserved cobalamin operon protein |
Gene: OE3224F: conserved cobalamin operon protein |
Gene: VNG1562H: conserved cobalamin operon protein |
Gene: HVO_B0053: conserved cobalamin operon protein |
Gene: Hmuk_1865: conserved cobalamin operon protein |
Gene: HQ3031A: conserved cobalamin operon protein |
|
Gene: Hlac_3469: conserved cobalamin operon protein |
Gene: Htur_0987: conserved cobalamin operon protein |
|
Gene: NP1106A: conserved cobalamin operon protein |
conserved cobalamin operon protein |
| cobT |
Gene: rrnAC1101: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
*2
Halobacterium salinarum R1 Gene: OE3227F: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) Site: position = -120 score = 4.77874 sequence = AACCCAACTGTGGTTGCATA Gene: OE3242F: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
*2
Halobacterium sp. NRC-1 Gene: VNG1564H: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) Site: position = -219 score = 4.77874 sequence = AACCCAACTGTGGTTGCATA Gene: VNG1572C: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
Gene: HVO_0590: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
Gene: Hmuk_2245: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
Gene: HQ1408A: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
Gene: Huta_2498: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
Gene: Hlac_0230: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
Gene: Htur_2836: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
Gene: Nmag_0990: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
*
Natronomonas pharaonis DSM 2160 Site: position = -33 score = 4.10747 sequence = GGTTCAAGTACACTTGTCCA Site: position = -97 score = 4.37519 sequence = ACAGCAATTCGGCTTGTACA Site: position = -117 score = 5.40741 sequence = TAATCAAGTATAGTTGTATT Gene: NP0736A: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21) |
| cbiA |
Gene: rrnAC1102: Cobyrinic acid A,C-diamide synthase |
Gene: OE3243F: Cobyrinic acid A,C-diamide synthase |
Gene: VNG1573G: Cobyrinic acid A,C-diamide synthase |
Gene: HVO_A0487: Cobyrinic acid A,C-diamide synthase |
Gene: Hmuk_1855: Cobyrinic acid A,C-diamide synthase |
Gene: HQ1829A: Cobyrinic acid A,C-diamide synthase |
|
Gene: Hlac_0231: Cobyrinic acid A,C-diamide synthase |
Gene: Htur_0999: Cobyrinic acid A,C-diamide synthase |
*
Natrialba magadii ATCC 43099 Site: position = -115 score = 4.42529 sequence = AGTTCAAGTACAGTTGTGTG Gene: Nmag_3175: Cobyrinic acid A,C-diamide synthase |
Gene: NP0738A: Cobyrinic acid A,C-diamide synthase |
Cobyrinic acid A,C-diamide synthase |
| btuR |
Gene: rrnAC1936: Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
Gene: OE3245F: Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
Gene: VNG1574G: Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
Gene: HVO_A0488: Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
Gene: Hmuk_0139: Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
Gene: HQ1405A: Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
Gene: Huta_2501: Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
Gene: Hlac_0237: Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
Gene: Htur_5207: Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
Gene: Nmag_3073: Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
Gene: NP4974A: Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
Cob(I)alamin adenosyltransferase (EC 2.5.1.17) |
| cbiP |
Gene: rrnAC1938: Cobyric acid synthase |
Gene: OE3246F: Cobyric acid synthase |
Gene: VNG1576G: Cobyric acid synthase |
Gene: HVO_A0553: Cobyric acid synthase |
Gene: Hmuk_1854: Cobyric acid synthase |
Gene: HQ1404A: Cobyric acid synthase |
Gene: Huta_2504: Cobyric acid synthase |
Gene: Hlac_0238: Cobyric acid synthase |
Gene: Htur_5212: Cobyric acid synthase |
Gene: Nmag_3068: Cobyric acid synthase |
Gene: NP5126A: Cobyric acid synthase |
Cobyric acid synthase |
| VNG1577C |
|
Gene: OE3249F: conserved cobalamine operon protein, HAD family hydrolase |
Gene: VNG1577C: conserved cobalamine operon protein, HAD family hydrolase |
Gene: HVO_0586: conserved cobalamine operon protein, HAD family hydrolase |
*
Halomicrobium mukohataei DSM 12286 Site: position = -32 score = 4.59199 sequence = AGTTCAAGTGTGCTTGCGGT Gene: Hmuk_0145: conserved cobalamine operon protein, HAD family hydrolase |
Gene: HQ1412A: conserved cobalamine operon protein, HAD family hydrolase |
|
Gene: Hlac_0642: conserved cobalamine operon protein, HAD family hydrolase |
Gene: Htur_2832: conserved cobalamine operon protein, HAD family hydrolase |
Gene: Nmag_0986: conserved cobalamine operon protein, HAD family hydrolase |
Gene: NP5310A: conserved cobalamine operon protein, HAD family hydrolase |
conserved cobalamine operon protein, HAD family hydrolase |
| cbiB |
Gene: rrnAC1930: Adenosylcobinamide-phosphate synthase |
Gene: OE3253F: Adenosylcobinamide-phosphate synthase |
Gene: VNG1578H: Adenosylcobinamide-phosphate synthase |
Gene: HVO_0587: Adenosylcobinamide-phosphate synthase |
Gene: Hmuk_0144: Adenosylcobinamide-phosphate synthase |
Gene: HQ1411A: Adenosylcobinamide-phosphate synthase |
Gene: Huta_2495: Adenosylcobinamide-phosphate synthase |
Gene: Hlac_0232: Adenosylcobinamide-phosphate synthase |
Gene: Htur_2833: Adenosylcobinamide-phosphate synthase |
Gene: Nmag_0987: Adenosylcobinamide-phosphate synthase |
Gene: NP5308A: Adenosylcobinamide-phosphate synthase |
Adenosylcobinamide-phosphate synthase |
| cobS |
Gene: rrnAC1931: Cobalamin synthase |
Gene: OE3255F: Cobalamin synthase |
Gene: VNG1580H: Cobalamin synthase |
Gene: HVO_0588: Cobalamin synthase |
Gene: Hmuk_0143: Cobalamin synthase |
Gene: HQ1410A: Cobalamin synthase |
Gene: Huta_2496: Cobalamin synthase |
Gene: Hlac_0233: Cobalamin synthase |
Gene: Htur_2834: Cobalamin synthase |
Gene: Nmag_0988: Cobalamin synthase |
Gene: NP5306A: Cobalamin synthase |
Cobalamin synthase |
| cobY |
Gene: rrnAC1932: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
Gene: OE3257F: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
Gene: VNG1581C: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
Gene: HVO_0589: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
Gene: Hmuk_0142: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
Gene: HQ1409A: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
Gene: Huta_2497: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
Gene: Hlac_0234: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
Gene: Htur_2835: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
Gene: Nmag_0989: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
Gene: NP5304A: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62) |
| cobD |
Gene: rrnAC1934: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: OE3259F: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: VNG1582G: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
2
Haloferax volcanii DS2 Gene: HVO_0593: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) Gene: HVO_0591: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: Hmuk_0141: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: HQ1407A: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: Huta_2499: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: Hlac_0235: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: Htur_2837: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: Nmag_0991: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: NP5302A: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
| cbiZ |
Gene: rrnAC1935: Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
Gene: OE3261F: Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
Gene: VNG1583C: Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
Gene: HVO_0592: Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
Gene: Hmuk_0140: Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
Gene: HQ1406A: Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
Gene: Huta_2500: Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
Gene: Hlac_0236: Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
Gene: Htur_2838: Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
Gene: Nmag_0992: Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
Gene: NP5300A: Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
Adenosylcobinamide amidohydrolase (EC 3.5.1.90) |
| btuF |
Gene: rrnAC3375: Vitamin B12 ABC transporter, B12-binding component BtuF |
Gene: OE2951R: Vitamin B12 ABC transporter, B12-binding component BtuF |
Gene: VNG1369G: Vitamin B12 ABC transporter, B12-binding component BtuF |
Gene: HVO_1110: Vitamin B12 ABC transporter, B12-binding component BtuF |
*
Halomicrobium mukohataei DSM 12286 Site: position = -60 score = 4.06726 sequence = GTTCCAACCACAGTTGGGAT Gene: Hmuk_2791: Vitamin B12 ABC transporter, B12-binding component BtuF |
*
Haloquadratum walsbyi DSM 16790 Site: position = -64 score = 4.64993 sequence = TATACAAACGCACTTGCAGT Gene: HQ1628A: Vitamin B12 ABC transporter, B12-binding component BtuF |
*
Halorhabdus utahensis DSM 12940 Site: position = -59 score = 4.60461 sequence = ACGACAAGTTGAGTTGCATT Gene: Huta_2494: Vitamin B12 ABC transporter, B12-binding component BtuF |
*
Halorubrum lacusprofundi ATCC 49239 Site: position = -58 score = 4.28481 sequence = TCTCCAACAAAACTTGTAGT Gene: Hlac_0880: Vitamin B12 ABC transporter, B12-binding component BtuF |
*
Haloterrigena turkmenica DSM 5511 Site: position = -58 score = 4.70745 sequence = GATCCAACCACGGTTGGTTT Gene: Htur_1830: Vitamin B12 ABC transporter, B12-binding component BtuF |
*2
Natrialba magadii ATCC 43099 Site: position = -58 score = 4.89006 sequence = AATGCAACTCTGATTGCAAT Gene: Nmag_1837: Vitamin B12 ABC transporter, B12-binding component BtuF Site: position = -58 score = 4.9868 sequence = TGTGCAAGCATGATTGCTTT Gene: Nmag_3605: Vitamin B12 ABC transporter, B12-binding component BtuF |
*
Natronomonas pharaonis DSM 2160 Site: position = -57 score = 4.1954 sequence = GCTGCAACTGGGCTTGGTTT Gene: NP3814A: Vitamin B12 ABC transporter, B12-binding component BtuF |
Vitamin B12 ABC transporter, B12-binding component BtuF |
| CRON 2. | ||||||||||||
| chlID |
*
Haloarcula marismortui ATCC 43049 Site: position = -9 score = 5.86458 sequence = AATACAAGTATGGTTGTATT Gene: rrnAC3018: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis |
*
Halobacterium salinarum R1 Site: position = -9 score = 5.45308 sequence = ATTACAACTATGGTTGATTT Gene: OE3229R: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis |
*
Halobacterium sp. NRC-1 Site: position = -9 score = 5.45308 sequence = ATTACAACTATGGTTGATTT Gene: VNG1565G: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis |
Gene: HVO_B0051: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis |
*
Halomicrobium mukohataei DSM 12286 Site: position = -9 score = 5.52886 sequence = AATACAAGCATGATTGATTT Gene: Hmuk_1860: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis |
*
Haloquadratum walsbyi DSM 16790 Site: position = -18 score = 4.15721 sequence = AGTGCAAAAAAGGTTGATAT Gene: HQ2295A: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis |
|
*
Halorubrum lacusprofundi ATCC 49239 Site: position = -9 score = 5.40043 sequence = ACTACAACCATGGTTGATTT Gene: Hlac_3462: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis |
*
Haloterrigena turkmenica DSM 5511 Site: position = -9 score = 4.60058 sequence = AGCGCAACTATGGTTGCAGA Gene: Htur_1006: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis |
|
*
Natronomonas pharaonis DSM 2160 Site: position = -29 score = 4.01304 sequence = TGATAAACTCCGGTTGTTCT Site: position = -9 score = 4.64701 sequence = AATACAACCGTGATTGACAA Gene: NP1094A: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis |
ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis |
| cbtB |
*
Haloarcula marismortui ATCC 43049 Site: position = -39 score = 5.12809 sequence = TTTACAATCTTACTTGTTCT Gene: rrnAC3016: Cobalt transporter subunit CbtB, putative |
|
|
*
Haloferax volcanii DS2 Site: position = -142 score = 5.43003 sequence = AAAACAATTGTGCTTGTTGT Site: position = -66 score = 5.10688 sequence = AACACAATCTCGCTTGTTCT Site: position = -39 score = 5.04933 sequence = TTTACAACTGTGCTTGGTTT Gene: HVO_B0063: Cobalt transporter subunit CbtB, putative |
*
Halomicrobium mukohataei DSM 12286 Site: position = -38 score = 4.73694 sequence = TTTACAATCTAGTTTGTACT Gene: Hmuk_1861: Cobalt transporter subunit CbtB, putative |
|
|
*
Halorubrum lacusprofundi ATCC 49239 Site: position = -39 score = 4.91175 sequence = TTTACAAGCTCAGTTGTGTT Gene: Hlac_3463: Cobalt transporter subunit CbtB, putative |
*
Haloterrigena turkmenica DSM 5511 Site: position = -37 score = 5.33734 sequence = TTTACAACTATACTTGTTCT Gene: Htur_5160: Cobalt transporter subunit CbtB, putative |
|
Gene: NP1096A: Cobalt transporter subunit CbtB, putative |
Cobalt transporter subunit CbtB, putative |
| cbtA |
*
Haloarcula marismortui ATCC 43049 Site: position = -245 score = 5.12809 sequence = TTTACAATCTTACTTGTTCT Gene: rrnAC3015: Predicted cobalt transporter CbtA |
|
|
*
Haloferax volcanii DS2 Site: position = -227 score = 5.04933 sequence = TTTACAACTGTGCTTGGTTT Gene: HVO_B0064: Predicted cobalt transporter CbtA |
*
Halomicrobium mukohataei DSM 12286 Site: position = -229 score = 4.73694 sequence = TTTACAATCTAGTTTGTACT Gene: Hmuk_1862: Predicted cobalt transporter CbtA |
|
|
*
Halorubrum lacusprofundi ATCC 49239 Site: position = -229 score = 4.91175 sequence = TTTACAAGCTCAGTTGTGTT Gene: Hlac_3464: Predicted cobalt transporter CbtA |
*
Haloterrigena turkmenica DSM 5511 Site: position = -229 score = 5.33734 sequence = TTTACAACTATACTTGTTCT Gene: Htur_5161: Predicted cobalt transporter CbtA |
|
Gene: NP1098A: Predicted cobalt transporter CbtA |
Predicted cobalt transporter CbtA |
| cbiX_2 |
|
|
|
Gene: HVO_B0065: conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein) |
Gene: Hmuk_1863: conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein) |
|
|
Gene: Hlac_3465: conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein) |
Gene: Htur_5162: conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein) |
|
Gene: NP1100A: conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein) |
conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein) |
| CRON 3. | ||||||||||||
| cobN |
*
Haloarcula marismortui ATCC 43049 Site: position = -46 score = 5.86458 sequence = AATACAACCATACTTGTATT Gene: rrnAC3019: CobN component of cobalt chelatase involved in B12 biosynthesis |
*
Halobacterium salinarum R1 Site: position = -45 score = 5.45308 sequence = AAATCAACCATAGTTGTAAT Gene: OE3230F: CobN component of cobalt chelatase involved in B12 biosynthesis |
*
Halobacterium sp. NRC-1 Site: position = -240 score = 5.45308 sequence = AAATCAACCATAGTTGTAAT Gene: VNG1566G: CobN component of cobalt chelatase involved in B12 biosynthesis |
Gene: HVO_B0050: CobN component of cobalt chelatase involved in B12 biosynthesis |
*
Halomicrobium mukohataei DSM 12286 Site: position = -45 score = 5.52886 sequence = AAATCAATCATGCTTGTATT Gene: Hmuk_1859: CobN component of cobalt chelatase involved in B12 biosynthesis |
*
Haloquadratum walsbyi DSM 16790 Site: position = -45 score = 4.15721 sequence = ATATCAACCTTTTTTGCACT Gene: HQ2296A: CobN component of cobalt chelatase involved in B12 biosynthesis |
|
*
Halorubrum lacusprofundi ATCC 49239 Site: position = -45 score = 5.40043 sequence = AAATCAACCATGGTTGTAGT Gene: Hlac_3461: CobN component of cobalt chelatase involved in B12 biosynthesis |
*
Haloterrigena turkmenica DSM 5511 Site: position = -45 score = 4.60058 sequence = TCTGCAACCATAGTTGCGCT Gene: Htur_1005: CobN component of cobalt chelatase involved in B12 biosynthesis |
|
*
Natronomonas pharaonis DSM 2160 Site: position = -45 score = 4.64701 sequence = TTGTCAATCACGGTTGTATT Site: position = -25 score = 4.01304 sequence = AGAACAACCGGAGTTTATCA Gene: NP1092A: CobN component of cobalt chelatase involved in B12 biosynthesis |
CobN component of cobalt chelatase involved in B12 biosynthesis |
| cbiC |
Gene: rrnAC3020: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
Gene: OE3237F: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
Gene: VNG1567G: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
Gene: HVO_B0049: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
Gene: Hmuk_1858: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
Gene: HQ2297A: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
|
Gene: Hlac_3460: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
Gene: Htur_1004: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
|
Gene: NP1090A: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
| cbiJ |
Gene: rrnAC3021: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
Gene: OE3238F: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
Gene: VNG1568G: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
Gene: HVO_B0048: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
Gene: Hmuk_1857: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
*
Haloquadratum walsbyi DSM 16790 Site: position = -236 score = 4.25711 sequence = GTTGCAACCCCGGTTGGATT Gene: HQ2298A: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
|
Gene: Hlac_3459: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
Gene: Htur_1003: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
|
Gene: NP1088A: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
| CRON 4. | ||||||||||||
| cbiD-II |
*
Haloarcula marismortui ATCC 43049 Site: position = -37 score = 5.40567 sequence = AAAACAACTCAGCTTGTTTT Gene: rrnAC3023: B12 biosynthesis-related protein, possible CbiD equivalent |
*
Halobacterium salinarum R1 Site: position = -44 score = 4.77874 sequence = TATGCAACCACAGTTGGGTT Gene: OE3239R: B12 biosynthesis-related protein, possible CbiD equivalent |
*
Halobacterium sp. NRC-1 Site: position = -44 score = 4.77874 sequence = TATGCAACCACAGTTGGGTT Gene: VNG1570H: B12 biosynthesis-related protein, possible CbiD equivalent |
|
*
Halomicrobium mukohataei DSM 12286 Site: position = -36 score = 4.99638 sequence = AGTACAACTACACTTGTACC Site: position = -56 score = 4.749 sequence = ATAGCAAGCACAATTGGTGT Gene: Hmuk_1856: B12 biosynthesis-related protein, possible CbiD equivalent |
|
|
*
Halorubrum lacusprofundi ATCC 49239 Site: position = -33 score = 4.41593 sequence = AGATAAAGTATAGTTGAACT Gene: Hlac_3458: B12 biosynthesis-related protein, possible CbiD equivalent |
|
|
*
Natronomonas pharaonis DSM 2160 Site: position = -27 score = 5.40741 sequence = AATACAACTATACTTGATTA Site: position = -47 score = 4.37519 sequence = TGTACAAGCCGAATTGCTGT Gene: NP0734A: B12 biosynthesis-related protein, possible CbiD equivalent |
B12 biosynthesis-related protein, possible CbiD equivalent |
| CRON 5. | ||||||||||||
| btuC |
Gene: rrnAC3374: Vitamin B12 ABC transporter, permease component BtuC |
Gene: OE2952F: Vitamin B12 ABC transporter, permease component BtuC |
Gene: VNG1370G: Vitamin B12 ABC transporter, permease component BtuC |
Gene: HVO_1111: Vitamin B12 ABC transporter, permease component BtuC |
*
Halomicrobium mukohataei DSM 12286 Site: position = -21 score = 4.06726 sequence = ATCCCAACTGTGGTTGGAAC Gene: Hmuk_2792: Vitamin B12 ABC transporter, permease component BtuC |
*
Haloquadratum walsbyi DSM 16790 Site: position = -26 score = 4.64993 sequence = ACTGCAAGTGCGTTTGTATA Gene: HQ1627A: Vitamin B12 ABC transporter, permease component BtuC |
*
Halorhabdus utahensis DSM 12940 Site: position = -1 score = 4.60461 sequence = AATGCAACTCAACTTGTCGT Gene: Huta_2493: Vitamin B12 ABC transporter, permease component BtuC |
*
Halorubrum lacusprofundi ATCC 49239 Site: position = -24 score = 4.28481 sequence = ACTACAAGTTTTGTTGGAGA Gene: Hlac_0881: Vitamin B12 ABC transporter, permease component BtuC |
*
Haloterrigena turkmenica DSM 5511 Site: position = -21 score = 4.70745 sequence = AAACCAACCGTGGTTGGATC Gene: Htur_1831: Vitamin B12 ABC transporter, permease component BtuC |
*
Natrialba magadii ATCC 43099 Site: position = -22 score = 4.9868 sequence = AAAGCAATCATGCTTGCACA Gene: Nmag_3606: Vitamin B12 ABC transporter, permease component BtuC |
*
Natronomonas pharaonis DSM 2160 Site: position = -21 score = 4.1954 sequence = AAACCAAGCCCAGTTGCAGC Gene: NP3816A: Vitamin B12 ABC transporter, permease component BtuC |
Vitamin B12 ABC transporter, permease component BtuC |
| btuD |
Gene: rrnAC3372: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: OE2955F: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: VNG1371Gm: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: HVO_1112: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: Hmuk_2793: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: HQ1626A: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: Huta_2492: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: Hlac_0882: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: Htur_1832: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: Nmag_3607: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: NP3818A: Vitamin B12 ABC transporter, ATPase component BtuD |
Vitamin B12 ABC transporter, ATPase component BtuD |
| CRON 6. | ||||||||||||
| nrdR |
|
|
|
|
*
Halomicrobium mukohataei DSM 12286 Site: position = -136 score = 4.90606 sequence = TAATCAAGTCTAATTGTACT Gene: Hmuk_3351: Ribonucleotide reductase transcriptional regulator NrdR |
|
*
Halorhabdus utahensis DSM 12940 Site: position = -133 score = 5.10158 sequence = AGTACAACTGAACTTGGACT Gene: Huta_2339: Ribonucleotide reductase transcriptional regulator NrdR |
*
Halorubrum lacusprofundi ATCC 49239 Site: position = -136 score = 5.46877 sequence = AATACAAGTTTAGTTGTGTT Gene: Hlac_2946: Ribonucleotide reductase transcriptional regulator NrdR |
|
*
Natrialba magadii ATCC 43099 Site: position = -136 score = 3.99336 sequence = AACACAAGTGAATTTTCACT Gene: Nmag_2658: Ribonucleotide reductase transcriptional regulator NrdR |
*
Natronomonas pharaonis DSM 2160 Site: position = -117 score = 4.259 sequence = ACACCAATTTTATTTGGAAA Site: position = -137 score = 4.95164 sequence = AAATCAAGTTCATTTGTACT Gene: NP6162A: Ribonucleotide reductase transcriptional regulator NrdR |
Ribonucleotide reductase transcriptional regulator NrdR |
| NP6164A |
|
|
|
|
|
|
|
|
|
|
Gene: NP6164A: hypothetical protein |
hypothetical protein |
| nrdB2 |
|
|
|
|
Gene: Hmuk_3350: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) |
|
|
Gene: Hlac_2945: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) |
|
|
Gene: NP6166A: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) |
Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) |
| nrdA2 |
|
|
|
|
Gene: Hmuk_3349: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) |
|
|
Gene: Hlac_2944: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) |
|
|
Gene: NP6168A: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) |
Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) |
| nrdA1 |
|
*
Halobacterium salinarum R1 Site: position = -153 score = 4.85074 sequence = TGATCAACTTAGATTGTACT Site: position = -133 score = 4.62208 sequence = TCTACAAGTTTAGTTGGTAA Gene: OE4346R: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) |
*
Halobacterium sp. NRC-1 Site: position = -153 score = 4.85074 sequence = TGATCAACTTAGATTGTACT Site: position = -133 score = 4.62208 sequence = TCTACAAGTTTAGTTGGTAA Gene: VNG2384G: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) |
|
|
|
Gene: Huta_2338: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) |
|
|
Gene: Nmag_2657: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) |
|
Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) |
| nrdB1 |
|
Gene: OE4345R: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) |
Gene: VNG2383G: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) |
|
|
|
Gene: Huta_2337: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) |
|
|
Gene: Nmag_2656: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) |
|
Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) |
| CRON 7. | ||||||||||||
| cbiM |
|
*
Halobacterium salinarum R1 Site: position = -69 score = 5.23546 sequence = AATACAAATTCAGTTGTTCT Gene: OE3319R: Substrate-specific component CbiM of cobalt ECF transporter |
*
Halobacterium sp. NRC-1 Site: position = -69 score = 5.23546 sequence = AATACAAATTCAGTTGTTCT Gene: VNG1635G: Substrate-specific component CbiM of cobalt ECF transporter |
|
|
*
Haloquadratum walsbyi DSM 16790 Site: position = -126 score = 5.3072 sequence = AAAACAATTACGCTTGCTCT Site: position = -60 score = 5.53781 sequence = AGTACAAGCAAAATTGTTTT Gene: HQ1835A: Substrate-specific component CbiM of cobalt ECF transporter |
|
|
|
|
|
Substrate-specific component CbiM of cobalt ECF transporter |
| cbiN |
|
Gene: OE3318R: Additional substrate-specific component CbiN of cobalt ECF transporter |
Gene: VNG1634G: Additional substrate-specific component CbiN of cobalt ECF transporter |
|
|
Gene: HQ1836A: Additional substrate-specific component CbiN of cobalt ECF transporter |
|
|
|
|
|
Additional substrate-specific component CbiN of cobalt ECF transporter |
| cbiQ |
|
Gene: OE3317R: Transmembrane component CbiQ of energizing module of cobalt ECF transporter |
Gene: VNG1632G: Transmembrane component CbiQ of energizing module of cobalt ECF transporter |
|
|
Gene: HQ1837A: Transmembrane component CbiQ of energizing module of cobalt ECF transporter |
|
|
|
|
|
Transmembrane component CbiQ of energizing module of cobalt ECF transporter |
| cbiO |
|
Gene: OE3315R: ATPase component CbiO of energizing module of cobalt ECF transporter |
Gene: VNG1631G: ATPase component CbiO of energizing module of cobalt ECF transporter |
|
|
Gene: HQ1838A: ATPase component CbiO of energizing module of cobalt ECF transporter |
|
|
|
|
|
ATPase component CbiO of energizing module of cobalt ECF transporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |