Regulon of CblR in Natrialba magadii ATCC 43099

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:
Regulation mode:
Biological process:	Cobalamin biosynthesis
Effector:
Regulog:	CblR - Halobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Halobacteriales
By trascription factor - CblR
By pathway - Cobalamin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -22 Score: 5 Sequence: AAAGCAATCATGCTTGCACA Locus tag: Nmag_3606 Name: btuC Funciton: Vitamin B12 ABC transporter, permease component BtuC Locus tag: Nmag_3607 Name: btuD Funciton: Vitamin B12 ABC transporter, ATPase component BtuD
	Nmag_3606	btuC	Vitamin B12 ABC transporter, permease component BtuC
	Nmag_3607	btuD	Vitamin B12 ABC transporter, ATPase component BtuD
Position: -136 Score: 4 Sequence: AACACAAGTGAATTTTCACT Locus tag: Nmag_2658 Name: nrdR Funciton: Ribonucleotide reductase transcriptional regulator NrdR Locus tag: Nmag_2657 Name: nrdA1 Funciton: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) Locus tag: Nmag_2656 Name: nrdB1 Funciton: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
	Nmag_2658	nrdR	Ribonucleotide reductase transcriptional regulator NrdR
	Nmag_2657	nrdA1	Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
	Nmag_2656	nrdB1	Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
Position: -58 Score: 4.9 Sequence: AATGCAACTCTGATTGCAAT Locus tag: Nmag_1837 Name: btuF Funciton: Vitamin B12 ABC transporter, B12-binding component BtuF
	Nmag_1837	btuF	Vitamin B12 ABC transporter, B12-binding component BtuF
Position: -58 Score: 5 Sequence: TGTGCAAGCATGATTGCTTT Locus tag: Nmag_3605 Name: btuF Funciton: Vitamin B12 ABC transporter, B12-binding component BtuF
	Nmag_3605	btuF	Vitamin B12 ABC transporter, B12-binding component BtuF
Position: -115 Score: 4.4 Sequence: AGTTCAAGTACAGTTGTGTG Locus tag: Nmag_3175 Name: cbiA Funciton: Cobyrinic acid A,C-diamide synthase
	Nmag_3175	cbiA	Cobyrinic acid A,C-diamide synthase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD