Statistics of regulated genes

Genome	Genes	Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367	5	4
Lactobacillus casei ATCC 334	4	3
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956	8	4
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1	9	5
Lactobacillus reuteri JCM 1112	8	4
Lactobacillus rhamnosus GG	5	4
Lactobacillus sakei subsp. sakei 23K	9	5
Lactobacillus salivarius subsp. salivarius UCC118	5	4
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1	10	6
Pediococcus pentosaceus ATCC 25745	10	5

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes																Function
CRON 1.
hrcA	Lactobacillus acidophilus NCFM Gene: LBA1249: Heat shock response transcriptional regulator HrcA, HrcA family	Lactobacillus brevis ATCC 367 Gene: LVIS_1331: Heat shock response transcriptional regulator HrcA, HrcA family	Lactobacillus casei ATCC 334 Gene: LSEI_1567: Heat shock response transcriptional regulator HrcA, HrcA family	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_1229: Heat shock response transcriptional regulator HrcA, HrcA family	* Lactobacillus fermentum IFO 3956 Site: position = -89 score = 6.36329 sequence = AGATCTTTGACTTTTGTTGACTTT Gene: LAF_0749: Heat shock response transcriptional regulator HrcA, HrcA family	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533 Gene: LJ1481: Heat shock response transcriptional regulator HrcA, HrcA family	* Lactobacillus plantarum WCFS1 Site: position = -91 score = 5.89627 sequence = AATACTTTGTCTTTCCTTGACTTT Gene: lp_2029: Heat shock response transcriptional regulator HrcA, HrcA family	* Lactobacillus reuteri JCM 1112 Site: position = -101 score = 6.54452 sequence = AATTGTTTGACGTTTCTTGACTTT Gene: LAR_0677: Heat shock response transcriptional regulator HrcA, HrcA family	Lactobacillus rhamnosus GG Gene: LGG_01606: Heat shock response transcriptional regulator HrcA, HrcA family	* Lactobacillus sakei subsp. sakei 23K Site: position = -87 score = 5.25267 sequence = CAATTCTTGACTTTATTTGACGTT Gene: LSA1238: Heat shock response transcriptional regulator HrcA, HrcA family	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_0576: Heat shock response transcriptional regulator HrcA, HrcA family	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_1349: Heat shock response transcriptional regulator HrcA, HrcA family	Oenococcus oeni PSU-1	* Pediococcus pentosaceus ATCC 25745 Site: position = -107 score = 5.98678 sequence = AGATGTCTGACCAAATTTGACTAT Gene: PEPE_0894: Heat shock response transcriptional regulator HrcA, HrcA family	Heat shock response transcriptional regulator HrcA, HrcA family
grpE	Lactobacillus acidophilus NCFM Gene: LBA1248: Heat shock protein GrpE	Lactobacillus brevis ATCC 367 Gene: LVIS_1330: Heat shock protein GrpE	Lactobacillus casei ATCC 334 Gene: LSEI_1566: Heat shock protein GrpE	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_1228: Heat shock protein GrpE	Lactobacillus fermentum IFO 3956 Gene: LAF_0750: Heat shock protein GrpE	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533 Gene: LJ1480: Heat shock protein GrpE	Lactobacillus plantarum WCFS1 Gene: lp_2028: Heat shock protein GrpE	Lactobacillus reuteri JCM 1112 Gene: LAR_0678: Heat shock protein GrpE	Lactobacillus rhamnosus GG Gene: LGG_01605: Heat shock protein GrpE	Lactobacillus sakei subsp. sakei 23K Gene: LSA1237: Heat shock protein GrpE	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_0577: Heat shock protein GrpE	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_1348: Heat shock protein GrpE	* Oenococcus oeni PSU-1 Site: position = -71 score = 6.53601 sequence = AAATGTTTGACCAATCTTGACTAT Gene: OEOE_1310: Heat shock protein GrpE	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0895: Heat shock protein GrpE	Heat shock protein GrpE
dnaK	Lactobacillus acidophilus NCFM Gene: LBA1247: Chaperone protein DnaK	Lactobacillus brevis ATCC 367 Gene: LVIS_1329: Chaperone protein DnaK	Lactobacillus casei ATCC 334 Gene: LSEI_1565: Chaperone protein DnaK	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_1227: Chaperone protein DnaK	Lactobacillus fermentum IFO 3956 Gene: LAF_0751: Chaperone protein DnaK	Lactobacillus helveticus DPC 4571 Gene: lhv_1336: Chaperone protein DnaK	Lactobacillus johnsonii NCC 533 Gene: LJ1479: Chaperone protein DnaK	Lactobacillus plantarum WCFS1 Gene: lp_2027: Chaperone protein DnaK	Lactobacillus reuteri JCM 1112 Gene: LAR_0679: Chaperone protein DnaK	Lactobacillus rhamnosus GG Gene: LGG_01604: Chaperone protein DnaK	Lactobacillus sakei subsp. sakei 23K Gene: LSA1236: Chaperone protein DnaK	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_0578: Chaperone protein DnaK	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_1347: Chaperone protein DnaK	Oenococcus oeni PSU-1 Gene: OEOE_1309: Chaperone protein DnaK	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0896: Chaperone protein DnaK	Chaperone protein DnaK
dnaJ	Lactobacillus acidophilus NCFM Gene: LBA1246: Chaperone protein DnaJ	Lactobacillus brevis ATCC 367 Gene: LVIS_1328: Chaperone protein DnaJ	Lactobacillus casei ATCC 334 Gene: LSEI_1563: Chaperone protein DnaJ	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_1226: Chaperone protein DnaJ	Lactobacillus fermentum IFO 3956 Gene: LAF_0752: Chaperone protein DnaJ	Lactobacillus helveticus DPC 4571 Gene: lhv_1335: Chaperone protein DnaJ	Lactobacillus johnsonii NCC 533 Gene: LJ1478: Chaperone protein DnaJ	Lactobacillus plantarum WCFS1 Gene: lp_2026: Chaperone protein DnaJ	Lactobacillus reuteri JCM 1112 Gene: LAR_0680: Chaperone protein DnaJ	Lactobacillus rhamnosus GG Gene: LGG_01603: Chaperone protein DnaJ	Lactobacillus sakei subsp. sakei 23K Gene: LSA1235: Chaperone protein DnaJ	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_0579: Chaperone protein DnaJ	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_1346: Chaperone protein DnaJ	Oenococcus oeni PSU-1 Gene: OEOE_1308: Chaperone protein DnaJ	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0897: Chaperone protein DnaJ	Chaperone protein DnaJ
CRON 2.
groS	Lactobacillus acidophilus NCFM Gene: LBA0405: Heat shock protein 60 family co-chaperone GroES	Lactobacillus brevis ATCC 367 Gene: LVIS_0617: Heat shock protein 60 family co-chaperone GroES	Lactobacillus casei ATCC 334 Gene: LSEI_2239: Heat shock protein 60 family co-chaperone GroES	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_1497: Heat shock protein 60 family co-chaperone GroES	* Lactobacillus fermentum IFO 3956 Site: position = -153 score = -0.638308 sequence = TTGGTCAAAATTAGTCAAAGTTTT Gene: LAF_0325: Heat shock protein 60 family co-chaperone GroES	Lactobacillus helveticus DPC 4571 Gene: lhv_0425: Heat shock protein 60 family co-chaperone GroES	Lactobacillus johnsonii NCC 533 Gene: LJ0460: Heat shock protein 60 family co-chaperone GroES	Lactobacillus plantarum WCFS1 Gene: lp_0727: Heat shock protein 60 family co-chaperone GroES	* Lactobacillus reuteri JCM 1112 Site: position = -128 score = -1.14175 sequence = ATGGTCAAAAAAAGTCAAAGTGTT Gene: LAR_0342: Heat shock protein 60 family co-chaperone GroES	Lactobacillus rhamnosus GG Gene: LGG_02240: Heat shock protein 60 family co-chaperone GroES	Lactobacillus sakei subsp. sakei 23K Gene: LSA0358: Heat shock protein 60 family co-chaperone GroES	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_1212: Heat shock protein 60 family co-chaperone GroES	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_1763: Heat shock protein 60 family co-chaperone GroES	* Oenococcus oeni PSU-1 Site: position = -72 score = 6.71498 sequence = AAAAGTTTGACCTTTTTTGACCAA Gene: OEOE_1397: Heat shock protein 60 family co-chaperone GroES	* Pediococcus pentosaceus ATCC 25745 Site: position = -128 score = -0.872603 sequence = TTGGTTAATAAAGGTCAAAAATAC Gene: PEPE_0420: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groL	Lactobacillus acidophilus NCFM Gene: LBA0406: Heat shock protein 60 family chaperone GroEL	Lactobacillus brevis ATCC 367 Gene: LVIS_0618: Heat shock protein 60 family chaperone GroEL	Lactobacillus casei ATCC 334 Gene: LSEI_2238: Heat shock protein 60 family chaperone GroEL	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_1496: Heat shock protein 60 family chaperone GroEL	Lactobacillus fermentum IFO 3956 Gene: LAF_0326: Heat shock protein 60 family chaperone GroEL	Lactobacillus helveticus DPC 4571 Gene: lhv_0426: Heat shock protein 60 family chaperone GroEL	Lactobacillus johnsonii NCC 533 Gene: LJ0461: Heat shock protein 60 family chaperone GroEL	Lactobacillus plantarum WCFS1 Gene: lp_0728: Heat shock protein 60 family chaperone GroEL	Lactobacillus reuteri JCM 1112 Gene: LAR_0343: Heat shock protein 60 family chaperone GroEL	Lactobacillus rhamnosus GG Gene: LGG_02239: Heat shock protein 60 family chaperone GroEL	Lactobacillus sakei subsp. sakei 23K Gene: LSA0359: Heat shock protein 60 family chaperone GroEL	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_1211: Heat shock protein 60 family chaperone GroEL	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_1762: Heat shock protein 60 family chaperone GroEL	Oenococcus oeni PSU-1 Gene: OEOE_1396: Heat shock protein 60 family chaperone GroEL	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0421: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL
CRON 3.
clpP	Lactobacillus acidophilus NCFM Gene: LBA0694: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	* Lactobacillus brevis ATCC 367 Site: position = -90 score = 6.16577 sequence = TTTTGTTTGACCTACTCTGACCTT Gene: LVIS_0654: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	* Lactobacillus casei ATCC 334 Site: position = -85 score = 7.04585 sequence = AAATCTTTGACCTTATTTGACTTT Gene: LSEI_0963: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_0559: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	* Lactobacillus fermentum IFO 3956 Site: position = -90 score = 6.57105 sequence = AATGATTTGACCTTTTTTGACCTA Gene: LAF_0360: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	Lactobacillus helveticus DPC 4571 Gene: lhv_0735: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	Lactobacillus johnsonii NCC 533 Gene: LJ0869: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	* Lactobacillus plantarum WCFS1 Site: position = -92 score = 5.77559 sequence = TTTCTTTTGACCTTCACTGACCTT Gene: lp_0786: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	* Lactobacillus reuteri JCM 1112 Site: position = -93 score = 6.68814 sequence = AAACATTTGACCTTTTTTGACCAA Gene: LAR_0379: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	* Lactobacillus rhamnosus GG Site: position = -88 score = 7.04585 sequence = AAATCTTTGACCTTATTTGACTTT Gene: LGG_00931: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	* Lactobacillus sakei subsp. sakei 23K Site: position = -116 score = 6.02412 sequence = TACCATTTGACCATAGTTGACCTT Gene: LSA0531: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	* Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -101 score = 6.25078 sequence = TTAAATTTGACCATTATTGACCTT Gene: LSL_1168: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	* Oenococcus oeni PSU-1 Site: position = -63 score = 6.73198 sequence = AAAAGTTTGACCTTTCTTGACCAT Gene: OEOE_0570: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	* Pediococcus pentosaceus ATCC 25745 Site: position = -95 score = 6.86454 sequence = AAATATTTGACCTTTTTTGACCAA Gene: PEPE_0455: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
CRON 4.
hsp	Lactobacillus acidophilus NCFM Gene: LBA0205: Small heat shock protein	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334 Gene: LSEI_2800: Small heat shock protein	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_0243: Small heat shock protein	Lactobacillus fermentum IFO 3956 Gene: LAF_1369: Small heat shock protein	Lactobacillus helveticus DPC 4571 Gene: lhv_0222: Small heat shock protein	Lactobacillus johnsonii NCC 533 Gene: LJ0181: Small heat shock protein	Lactobacillus plantarum WCFS1 Gene: lp_0129: Small heat shock protein	Lactobacillus reuteri JCM 1112 Gene: LAR_1239: Small heat shock protein	Lactobacillus rhamnosus GG Gene: LGG_02804: Small heat shock protein	Lactobacillus sakei subsp. sakei 23K Gene: LSA0050: Small heat shock protein	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	* Oenococcus oeni PSU-1 Site: position = -96 score = 6.50893 sequence = TTTTATTTGACCTTTCTTGACTTT Gene: OEOE_0289: Small heat shock protein	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_1643: Small heat shock protein	Small heat shock protein
CRON 5.
clpB	Lactobacillus acidophilus NCFM	* Lactobacillus brevis ATCC 367 Site: position = -139 score = -1.6359 sequence = TTGGTCAAAAAAGGTCAAATTATT Gene: LVIS_0762: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	* Lactobacillus plantarum WCFS1 Site: position = -118 score = 6.47827 sequence = AAATCCTTGACCTTGTTTGACCTT Gene: lp_1903: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones	Lactobacillus reuteri JCM 1112	* Lactobacillus rhamnosus GG Site: position = -73 score = 6.17843 sequence = AATAGTTTGACCTTAACTGACCAA Gene: LGG_01367: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones	* Lactobacillus sakei subsp. sakei 23K Site: position = -89 score = 6.53688 sequence = GAATGTTTGACCTATTTTGACTAT Gene: LSA1040: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones	* Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -75 score = -0.985392 sequence = AAGGTCAAACTTAGTCAAAGTTTA Gene: LSL_0863: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_1096: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones	ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
CRON 6.
ctsR	Lactobacillus acidophilus NCFM	* Lactobacillus brevis ATCC 367 Site: position = -45 score = -1.08473 sequence = TTAGTCAGCATTAGTCAAATAAGT Gene: LVIS_1701: Stress and heat shock response transcriptional regulator CtsR, CtsR family	* Lactobacillus casei ATCC 334 Site: position = -39 score = -0.0397677 sequence = ATAGTCAAGATTGGTCAAAGTCAA Gene: LSEI_2518: Stress and heat shock response transcriptional regulator CtsR, CtsR family	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956 Gene: LAF_1527: Stress and heat shock response transcriptional regulator CtsR, CtsR family	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	* Lactobacillus plantarum WCFS1 Site: position = -41 score = -0.277144 sequence = ATAGTCAATATTAGTCAAAGATAA Gene: lp_1018: Stress and heat shock response transcriptional regulator CtsR, CtsR family	Lactobacillus reuteri JCM 1112 Gene: LAR_1405: Stress and heat shock response transcriptional regulator CtsR, CtsR family	* Lactobacillus rhamnosus GG Site: position = -39 score = -0.0397677 sequence = ATAGTCAAGATTGGTCAAAGTCAA Gene: LGG_02500: Stress and heat shock response transcriptional regulator CtsR, CtsR family	* Lactobacillus sakei subsp. sakei 23K Site: position = -77 score = -0.816409 sequence = ATAGTCAACGTTAGTCAAAGTTAA Gene: LSA1780: Stress and heat shock response transcriptional regulator CtsR, CtsR family	* Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -42 score = -0.958259 sequence = AAAGTCAATGTAGGTCAAACCTAC Gene: LSL_0195: Stress and heat shock response transcriptional regulator CtsR, CtsR family	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	* Oenococcus oeni PSU-1 Site: position = -21 score = -0.891367 sequence = TTAGTCAGGAATGGTCAAATTATG Gene: OEOE_0513: Stress and heat shock response transcriptional regulator CtsR, CtsR family	* Pediococcus pentosaceus ATCC 25745 Site: position = -38 score = -0.616609 sequence = ATAGTCAACATTAGTCAGAGTATA Gene: PEPE_1428: Stress and heat shock response transcriptional regulator CtsR, CtsR family	Stress and heat shock response transcriptional regulator CtsR, CtsR family
clpC	Lactobacillus acidophilus NCFM Gene: LBA0283: ATP-dependent Clp protease ATP-binding subunit ClpC	Lactobacillus brevis ATCC 367 Gene: LVIS_1700: ATP-dependent Clp protease ATP-binding subunit ClpC	Lactobacillus casei ATCC 334 Gene: LSEI_2517: ATP-dependent Clp protease ATP-binding subunit ClpC	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_0339: ATP-dependent Clp protease ATP-binding subunit ClpC	Lactobacillus fermentum IFO 3956 Gene: LAF_1526: ATP-dependent Clp protease ATP-binding subunit ClpC	Lactobacillus helveticus DPC 4571 Gene: lhv_0301: ATP-dependent Clp protease ATP-binding subunit ClpC	Lactobacillus johnsonii NCC 533 Gene: LJ0331: ATP-dependent Clp protease ATP-binding subunit ClpC	Lactobacillus plantarum WCFS1 Gene: lp_1019: ATP-dependent Clp protease ATP-binding subunit ClpC	Lactobacillus reuteri JCM 1112 Gene: LAR_1404: ATP-dependent Clp protease ATP-binding subunit ClpC	Lactobacillus rhamnosus GG Gene: LGG_02499: ATP-dependent Clp protease ATP-binding subunit ClpC	Lactobacillus sakei subsp. sakei 23K Gene: LSA1779: ATP-dependent Clp protease ATP-binding subunit ClpC	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_0196: ATP-dependent Clp protease ATP-binding subunit ClpC	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0185: ATP-dependent Clp protease ATP-binding subunit ClpC	Oenococcus oeni PSU-1 Gene: OEOE_0514: ATP-dependent Clp protease ATP-binding subunit ClpC	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_1427: ATP-dependent Clp protease ATP-binding subunit ClpC	ATP-dependent Clp protease ATP-binding subunit ClpC
CRON 7.
clpE	Lactobacillus acidophilus NCFM Gene: LBA0638: ATP-dependent Clp protease, ATP-binding subunit ClpE	* Lactobacillus brevis ATCC 367 Site: position = -84 score = 0.606989 sequence = ATGGTCAAGAAAGGTCAAGCCTTT Gene: LVIS_1554: ATP-dependent Clp protease, ATP-binding subunit ClpE	* Lactobacillus casei ATCC 334 Site: position = -198 score = 0.0981333 sequence = TAGGTCAAGAAAGGTCAAACCTTT Gene: LSEI_1762: ATP-dependent Clp protease, ATP-binding subunit ClpE	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_0510: ATP-dependent Clp protease, ATP-binding subunit ClpE	* Lactobacillus fermentum IFO 3956 Site: position = -48 score = -0.667882 sequence = ATGGTCAAGAAAAGTCAAAGGTTG Gene: LAF_1388: ATP-dependent Clp protease, ATP-binding subunit ClpE	Lactobacillus helveticus DPC 4571 Gene: lhv_0683: ATP-dependent Clp protease, ATP-binding subunit ClpE	Lactobacillus johnsonii NCC 533 Gene: LJ0815: ATP-dependent Clp protease, ATP-binding subunit ClpE	* Lactobacillus plantarum WCFS1 Site: position = -93 score = -2.25379 sequence = AAGGTCAACAAAGGTCAAAGAGCC Gene: lp_1269: ATP-dependent Clp protease, ATP-binding subunit ClpE	* Lactobacillus reuteri JCM 1112 Site: position = -59 score = 0.175316 sequence = ATGGTCAAGAAAGGTCAAAACATT Gene: LAR_1257: ATP-dependent Clp protease, ATP-binding subunit ClpE	* Lactobacillus rhamnosus GG Site: position = -69 score = 0.0981333 sequence = TAGGTCAAGAAAGGTCAAACCTTT Gene: LGG_01823: ATP-dependent Clp protease, ATP-binding subunit ClpE	* Lactobacillus sakei subsp. sakei 23K Site: position = -66 score = -1.83873 sequence = AAGGTCAAAGATAGTCAAACAAAC Gene: LSA1465: ATP-dependent Clp protease, ATP-binding subunit ClpE	* Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -57 score = -1.61934 sequence = AAGGTCAAAGTTGGTCAAAATAAC Gene: LSL_0386: ATP-dependent Clp protease, ATP-binding subunit ClpE	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0571: ATP-dependent Clp protease, ATP-binding subunit ClpE	* Oenococcus oeni PSU-1 Site: position = -27 score = -1.34149 sequence = AAGGTCAATAAAGGTCAAACATTG Gene: OEOE_0640: ATP-dependent Clp protease, ATP-binding subunit ClpE	* Pediococcus pentosaceus ATCC 25745 Site: position = -223 score = -1.46087 sequence = ATGGTCAATATTGGTCAAACATCA Gene: PEPE_0607: ATP-dependent Clp protease, ATP-binding subunit ClpE	ATP-dependent Clp protease, ATP-binding subunit ClpE

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD