Regulon of CtsR in Lactobacillus rhamnosus GG

Properties
Regulator type:	Transcription factor
TF locus tag:	LGG_02500
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 6.2 Sequence: AATAGTTTGACCTTAACTGACCAA Locus tag: LGG_01367 Name: clpB Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
	LGG_01367	clpB	ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
Position: -39 Score: -0 Sequence: ATAGTCAAGATTGGTCAAAGTCAA Locus tag: LGG_02500 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: LGG_02499 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	LGG_02500	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	LGG_02499	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -69 Score: 0.1 Sequence: TAGGTCAAGAAAGGTCAAACCTTT Locus tag: LGG_01823 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	LGG_01823	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -88 Score: 7 Sequence: AAATCTTTGACCTTATTTGACTTT Locus tag: LGG_00931 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	LGG_00931	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD