Regulon of CtsR in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type:	Transcription factor
TF locus tag:	PEPE_1428
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -107 Score: 6 Sequence: AGATGTCTGACCAAATTTGACTAT Locus tag: PEPE_0894 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: PEPE_0895 Name: grpE Funciton: Heat shock protein GrpE Locus tag: PEPE_0896 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: PEPE_0897 Name: dnaJ Funciton: Chaperone protein DnaJ
	PEPE_0894	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	PEPE_0895	grpE	Heat shock protein GrpE
	PEPE_0896	dnaK	Chaperone protein DnaK
	PEPE_0897	dnaJ	Chaperone protein DnaJ
Position: -38 Score: -0.6 Sequence: ATAGTCAACATTAGTCAGAGTATA Locus tag: PEPE_1428 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: PEPE_1427 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	PEPE_1428	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	PEPE_1427	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -128 Score: -0.9 Sequence: TTGGTTAATAAAGGTCAAAAATAC Locus tag: PEPE_0420 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: PEPE_0421 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	PEPE_0420	groS	Heat shock protein 60 family co-chaperone GroES
	PEPE_0421	groL	Heat shock protein 60 family chaperone GroEL
Position: -223 Score: -1.5 Sequence: ATGGTCAATATTGGTCAAACATCA Locus tag: PEPE_0607 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	PEPE_0607	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -95 Score: 6.9 Sequence: AAATATTTGACCTTTTTTGACCAA Locus tag: PEPE_0455 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	PEPE_0455	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD