Regulon of CtsR in Lactobacillus casei ATCC 334

Properties
Regulator type:	Transcription factor
TF locus tag:	LSEI_2518
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 7 Sequence: AAATCTTTGACCTTATTTGACTTT Locus tag: LSEI_0963 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	LSEI_0963	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -39 Score: -0 Sequence: ATAGTCAAGATTGGTCAAAGTCAA Locus tag: LSEI_2518 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: LSEI_2517 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	LSEI_2518	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	LSEI_2517	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -198 Score: 0.1 Sequence: TAGGTCAAGAAAGGTCAAACCTTT Locus tag: LSEI_1762 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	LSEI_1762	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD