Regulon of CtsR in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type:	Transcription factor
TF locus tag:	LSL_0195
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -101 Score: 6.3 Sequence: TTAAATTTGACCATTATTGACCTT Locus tag: LSL_1168 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	LSL_1168	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -42 Score: -1 Sequence: AAAGTCAATGTAGGTCAAACCTAC Locus tag: LSL_0195 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: LSL_0196 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	LSL_0195	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	LSL_0196	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -75 Score: -1 Sequence: AAGGTCAAACTTAGTCAAAGTTTA Locus tag: LSL_0863 Name: clpB Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
	LSL_0863	clpB	ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
Position: -57 Score: -1.6 Sequence: AAGGTCAAAGTTGGTCAAAATAAC Locus tag: LSL_0386 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	LSL_0386	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD