Regulon of CtsR in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type:	Transcription factor
TF locus tag:	LSA1780
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -116 Score: 6 Sequence: TACCATTTGACCATAGTTGACCTT Locus tag: LSA0531 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	LSA0531	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -89 Score: 6.5 Sequence: GAATGTTTGACCTATTTTGACTAT Locus tag: LSA1040 Name: clpB Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
	LSA1040	clpB	ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
Position: -87 Score: 5.3 Sequence: CAATTCTTGACTTTATTTGACGTT Locus tag: LSA1238 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: LSA1237 Name: grpE Funciton: Heat shock protein GrpE Locus tag: LSA1236 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: LSA1235 Name: dnaJ Funciton: Chaperone protein DnaJ
	LSA1238	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	LSA1237	grpE	Heat shock protein GrpE
	LSA1236	dnaK	Chaperone protein DnaK
	LSA1235	dnaJ	Chaperone protein DnaJ
Position: -77 Score: -0.8 Sequence: ATAGTCAACGTTAGTCAAAGTTAA Locus tag: LSA1780 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: LSA1779 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	LSA1780	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	LSA1779	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -66 Score: -1.8 Sequence: AAGGTCAAAGATAGTCAAACAAAC Locus tag: LSA1465 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	LSA1465	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD