Regulon of CtsR in Lactobacillus reuteri JCM 1112

Properties
Regulator type:	Transcription factor
TF locus tag:	LAR_1405
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -101 Score: 6.5 Sequence: AATTGTTTGACGTTTCTTGACTTT Locus tag: LAR_0677 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: LAR_0678 Name: grpE Funciton: Heat shock protein GrpE Locus tag: LAR_0679 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: LAR_0680 Name: dnaJ Funciton: Chaperone protein DnaJ
	LAR_0677	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	LAR_0678	grpE	Heat shock protein GrpE
	LAR_0679	dnaK	Chaperone protein DnaK
	LAR_0680	dnaJ	Chaperone protein DnaJ
Position: -93 Score: 6.7 Sequence: AAACATTTGACCTTTTTTGACCAA Locus tag: LAR_0379 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	LAR_0379	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -128 Score: -1.1 Sequence: ATGGTCAAAAAAAGTCAAAGTGTT Locus tag: LAR_0342 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: LAR_0343 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	LAR_0342	groS	Heat shock protein 60 family co-chaperone GroES
	LAR_0343	groL	Heat shock protein 60 family chaperone GroEL
Position: -59 Score: 0.2 Sequence: ATGGTCAAGAAAGGTCAAAACATT Locus tag: LAR_1257 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	LAR_1257	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD