Orthologous regulated operons containing dnaK gene

Properties
Regulog:	CtsR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Phylum:	Firmicutes

Built upon 44 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus fermentum IFO 3956
Position: -89 Score: 6.36329 Sequence: AGATCTTTGACTTTTGTTGACTTT Locus tag: LAF_0749 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: LAF_0750 Name: grpE Funciton: Heat shock protein GrpE Locus tag: LAF_0751 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: LAF_0752 Name: dnaJ Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ	-89	6.4	AGATCTTTGACTTTTGTTGACTTT	LAF_0749
Lactobacillus plantarum WCFS1
Position: -91 Score: 5.89627 Sequence: AATACTTTGTCTTTCCTTGACTTT Locus tag: lp_2029 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: lp_2028 Name: grpE Funciton: Heat shock protein GrpE Locus tag: lp_2027 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: lp_2026 Name: dnaJ Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ	-91	5.9	AATACTTTGTCTTTCCTTGACTTT	lp_2029
Lactobacillus reuteri JCM 1112
Position: -101 Score: 6.54452 Sequence: AATTGTTTGACGTTTCTTGACTTT Locus tag: LAR_0677 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: LAR_0678 Name: grpE Funciton: Heat shock protein GrpE Locus tag: LAR_0679 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: LAR_0680 Name: dnaJ Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ	-101	6.5	AATTGTTTGACGTTTCTTGACTTT	LAR_0677
Lactobacillus sakei subsp. sakei 23K
Position: -87 Score: 5.25267 Sequence: CAATTCTTGACTTTATTTGACGTT Locus tag: LSA1238 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: LSA1237 Name: grpE Funciton: Heat shock protein GrpE Locus tag: LSA1236 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: LSA1235 Name: dnaJ Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ	-87	5.3	CAATTCTTGACTTTATTTGACGTT	LSA1238
Oenococcus oeni PSU-1
Position: -71 Score: 6.53601 Sequence: AAATGTTTGACCAATCTTGACTAT Locus tag: OEOE_1310 Name: grpE Funciton: Heat shock protein GrpE Locus tag: OEOE_1309 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: OEOE_1308 Name: dnaJ Funciton: Chaperone protein DnaJ
grpE-dnaK-dnaJ	-71	6.5	AAATGTTTGACCAATCTTGACTAT	OEOE_1310
Pediococcus pentosaceus ATCC 25745
Position: -107 Score: 5.98678 Sequence: AGATGTCTGACCAAATTTGACTAT Locus tag: PEPE_0894 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: PEPE_0895 Name: grpE Funciton: Heat shock protein GrpE Locus tag: PEPE_0896 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: PEPE_0897 Name: dnaJ Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ	-107	6	AGATGTCTGACCAAATTTGACTAT	PEPE_0894