Regulon of CtsR in Lactobacillus plantarum WCFS1

Properties
Regulator type:	Transcription factor
TF locus tag:	lp_1018
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: -0.3 Sequence: ATAGTCAATATTAGTCAAAGATAA Locus tag: lp_1018 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: lp_1019 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	lp_1018	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	lp_1019	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -93 Score: -2.3 Sequence: AAGGTCAACAAAGGTCAAAGAGCC Locus tag: lp_1269 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	lp_1269	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -91 Score: 5.9 Sequence: AATACTTTGTCTTTCCTTGACTTT Locus tag: lp_2029 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: lp_2028 Name: grpE Funciton: Heat shock protein GrpE Locus tag: lp_2027 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: lp_2026 Name: dnaJ Funciton: Chaperone protein DnaJ
	lp_2029	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	lp_2028	grpE	Heat shock protein GrpE
	lp_2027	dnaK	Chaperone protein DnaK
	lp_2026	dnaJ	Chaperone protein DnaJ
Position: -92 Score: 5.8 Sequence: TTTCTTTTGACCTTCACTGACCTT Locus tag: lp_0786 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	lp_0786	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -118 Score: 6.5 Sequence: AAATCCTTGACCTTGTTTGACCTT Locus tag: lp_1903 Name: clpB Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
	lp_1903	clpB	ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD