Regulon of CtsR in Lactobacillus brevis ATCC 367

Properties
Regulator type:	Transcription factor
TF locus tag:	LVIS_1701
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: -1.1 Sequence: TTAGTCAGCATTAGTCAAATAAGT Locus tag: LVIS_1701 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: LVIS_1700 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	LVIS_1701	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	LVIS_1700	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -139 Score: -1.6 Sequence: TTGGTCAAAAAAGGTCAAATTATT Locus tag: LVIS_0762 Name: clpB Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
	LVIS_0762	clpB	ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
Position: -84 Score: 0.6 Sequence: ATGGTCAAGAAAGGTCAAGCCTTT Locus tag: LVIS_1554 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	LVIS_1554	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -90 Score: 6.2 Sequence: TTTTGTTTGACCTACTCTGACCTT Locus tag: LVIS_0654 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	LVIS_0654	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD