Regulog Zur - Actinobacteria
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Acidothermus cellulolyticus 11B | 4 | 1 |
| Actinosynnema mirum DSM 43827 | 20 | 7 |
| Arthrobacter sp. FB24 | 4 | 2 |
| Bifidobacterium longum subsp. infantis ATCC 15697 | 6 | 4 |
| Brachybacterium faecium DSM 4810 | 5 | 2 |
| Brevibacterium linens BL2 | 7 | 5 |
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | 12 | 6 |
| Frankia sp. EAN1pec | 5 | 2 |
| Janibacter sp. HTCC2649 | 4 | 1 |
| Kocuria rhizophila DC2201 | 8 | 3 |
| Kytococcus sedentarius DSM 20547 | 4 | 1 |
| Leifsonia xyli subsp. xyli str. CTCB07 | 5 | 2 |
| Nakamurella multipartita DSM 44233 | 5 | 3 |
| Nocardioides sp. JS614 | 4 | 1 |
| Propionibacterium acnes KPA171202 | 13 | 4 |
| Rhodococcus sp. RHA1 | 16 | 7 |
| Saccharomonospora viridis DSM 43017 | 3 | 1 |
| Saccharopolyspora erythraea NRRL 2338 | 11 | 4 |
| Streptomyces coelicolor A3(2) | 16 | 5 |
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||||||
| Arth_3252 |
|
|
*
Arthrobacter sp. FB24 Site: position = -2 score = 5.18588 sequence = AAATGAGAATGATTCTCATAT Gene: Arth_3252: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| Arth_3253 |
|
|
Gene: Arth_3253: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| rpmJ2 |
|
|
Gene: Arth_3254: 50S ribosomal protein L36 |
Gene: Blon_1969: 50S ribosomal protein L36 |
|
|
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -34 score = 4.95748 sequence = TATTGAGAACCGTTCTCGTGA Gene: CMM_0025: 50S ribosomal protein L36 |
|
|
Gene: KRH_23160: 50S ribosomal protein L36 |
|
*
Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -34 score = 5.39758 sequence = TAATGATAATCTTTCTCAGTA Gene: Lxx20595: 50S ribosomal protein L36 |
|
|
|
|
|
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -64 score = 4.86747 sequence = TAACGATAATCATTATCGTCT Site: position = -70 score = 4.75576 sequence = AGTTGGTAACGATAATCATTA Gene: SACE_4627: 50S ribosomal protein L36 |
|
|
50S ribosomal protein L36 |
| CRON 2. | |||||||||||||||||||||
| sapD |
|
*
Actinosynnema mirum DSM 43827 Site: position = -61 score = 5.57305 sequence = TATTGAAAATGATTGTCCTTT Gene: Amir_4776: Conserved hypothetical protein CHP03773, ABC transporter-like |
|
|
|
|
|
|
|
|
|
Gene: Lxx20520: Conserved hypothetical protein CHP03773, ABC transporter-like |
|
|
*
Propionibacterium acnes KPA171202 Site: position = -49 score = 5.29179 sequence = AATCGATAACCGTTCTCATTA Gene: PPA1500: Conserved hypothetical protein CHP03773, ABC transporter-like |
|
|
|
|
|
Conserved hypothetical protein CHP03773, ABC transporter-like |
| troA |
|
*
Actinosynnema mirum DSM 43827 Site: position = -79 score = 5.0856 sequence = GATTGAAAACGGTTGTCGTTT Gene: Amir_4768: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: PPA1501: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
|
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| DIP0439 |
|
|
|
|
|
|
|
|
|
|
|
Gene: Lxx20480: Surface-anchored repeat, actinobacteria |
|
|
Gene: PPA1502: Surface-anchored repeat, actinobacteria |
|
|
|
|
|
Surface-anchored repeat, actinobacteria |
| DIP0440 |
|
Gene: Amir_4770: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: PPA1503: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
|
|
|
Zinc ABC transporter, ATP-binding protein ZnuC |
| DIP0441 |
|
Gene: Amir_4771: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
|
|
|
|
|
|
|
Gene: Lxx20450: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
Gene: PPA1504: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
|
|
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
| Amir_3101 |
|
*2
Actinosynnema mirum DSM 43827 Gene: Amir_4775: hypothetical protein Site: position = -66 score = 5.54283 sequence = AGTTGAAAACCGTTGTCATTT Gene: Amir_3101: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| Amir_4774 |
|
Gene: Amir_4774: protein of unknown function DUF916 cell surface putative |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
protein of unknown function DUF916 cell surface putative |
| yciC3 |
|
Gene: Amir_4773: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Rhodococcus sp. RHA1 Site: position = -25 score = 5.75291 sequence = TAATGAAAACAGTTATCATTT Gene: RHA1_ro05533: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
|
|
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
| Amir_4769 |
|
Gene: Amir_4769: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| CRON 3. | |||||||||||||||||||||
| KRH_17300 |
|
|
|
|
|
|
|
|
|
*
Kocuria rhizophila DC2201 Site: position = -120 score = 5.30713 sequence = TAACGAGAACCGTTATCATTT Gene: KRH_17300: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| KRH_17290 |
|
|
|
|
|
|
|
|
|
Gene: KRH_17290: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| yciC2 |
|
|
|
|
|
*
Brevibacterium linens BL2 Site: position = -56 score = 4.76076 sequence = TATTGAGAACGAGTATTATTA Gene: BlinB01002697: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
*2
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -31 score = 4.95748 sequence = TCACGAGAACGGTTCTCAATA Gene: CMM_0026: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Site: position = -32 score = 4.20362 sequence = AGATGAGAACGGTTCTCTTCT Gene: CMM_0314: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
Gene: KRH_17280: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
|
|
|
|
|
|
|
|
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
| CRON 4. | |||||||||||||||||||||
| yciC4 |
|
Gene: Amir_1028: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
|
*
Brevibacterium linens BL2 Site: position = -60 score = 5.73295 sequence = TAATGAAAAACGTTACCATTA Gene: BlinB01002695: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
Gene: Franean1_6990: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
Gene: KRH_15130: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
|
|
|
Gene: RHA1_ro06423: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
Gene: SACE_3297: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Gene: SCO5835: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
| CRON 5. | |||||||||||||||||||||
| znuA4 |
|
|
|
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -113 score = 5.56432 sequence = AAATGATAATAATTCTCAATA Gene: Blon_1963: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| CRON 6. | |||||||||||||||||||||
| znuC4 |
|
|
|
|
|
|
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -37 score = 4.43656 sequence = GAATGAGAATGCTTATCAACT Gene: CMM_0174: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
|
|
|
|
|
|
*
Rhodococcus sp. RHA1 Site: position = -8 score = 5.10227 sequence = TAACGATAATGATTGTCGTAA Gene: RHA1_ro02545: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
|
|
Zinc ABC transporter, ATP-binding protein ZnuC |
| CRON 7. | |||||||||||||||||||||
| znuB2 |
|
|
|
|
|
*
Brevibacterium linens BL2 Site: position = -25 score = 4.70085 sequence = TAACAATAATGGTTATCATCA Gene: BlinB01002692: Zinc ABC transporter, inner membrane permease protein ZnuB |
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -40 score = 4.43656 sequence = AGTTGATAAGCATTCTCATTC Gene: CMM_0175: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
|
|
|
Gene: Namu_1073: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
*
Rhodococcus sp. RHA1 Site: position = -31 score = 5.10227 sequence = TTACGACAATCATTATCGTTA Gene: RHA1_ro02546: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
*
Streptomyces coelicolor A3(2) Site: position = -34 score = 5.09772 sequence = TGTTGAACATGATTTTCATTG Gene: SCO0475: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
| SCO00474 |
|
|
|
|
|
*
Brevibacterium linens BL2 Site: position = -31 score = 5.38164 sequence = CAATGAGAACCATTATCAATA Gene: BlinB01002691: WD40/YVTN repeat-like-containing domain |
Gene: CMM_0176: WD40/YVTN repeat-like-containing domain |
|
|
|
|
|
|
|
|
Gene: RHA1_ro02547: WD40/YVTN repeat-like-containing domain |
|
|
Gene: SCO0474: WD40/YVTN repeat-like-containing domain |
|
WD40/YVTN repeat-like-containing domain |
| znuA2 |
|
|
|
|
|
Gene: BlinB01002690: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: CMM_0177: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Frankia sp. EAN1pec Site: position = -26 score = 5.0856 sequence = CATCGACAACCGTTTTCATTT Gene: Franean1_7253: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
|
Gene: Namu_1071: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
Gene: RHA1_ro02548: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
Gene: SCO0473: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| SCO0472 |
|
|
*
Arthrobacter sp. FB24 Site: position = -26 score = 5.23059 sequence = TAATGAGAATGACTATCATTT Gene: Arth_4108: WD40/YVTN repeat-like-containing domain |
|
*
Brachybacterium faecium DSM 4810 Site: position = -62 score = 4.70167 sequence = AGATGCGAACGATTATCAGTA Site: position = -17 score = 5.36976 sequence = TGATGAGAACGGTTTTCATGA Gene: Bfae_30770: WD40/YVTN repeat-like-containing domain |
Gene: BlinB01002689: WD40/YVTN repeat-like-containing domain |
Gene: CMM_0178: WD40/YVTN repeat-like-containing domain |
|
|
*2
Kocuria rhizophila DC2201 Gene: KRH_00830: WD40/YVTN repeat-like-containing domain Site: position = -83 score = 4.46619 sequence = AGATAAAAACGATTCTCATCT Gene: KRH_00820: WD40/YVTN repeat-like-containing domain |
|
|
Gene: Namu_1070: WD40/YVTN repeat-like-containing domain |
|
|
*
Rhodococcus sp. RHA1 Site: position = -47 score = 4.87787 sequence = CTTTGACAACCGTTTGCAATA Gene: RHA1_ro02549: WD40/YVTN repeat-like-containing domain |
|
|
Gene: SCO0472: WD40/YVTN repeat-like-containing domain |
|
WD40/YVTN repeat-like-containing domain |
| Franean1_7254 |
|
|
|
|
|
|
|
Gene: Franean1_7254: ABC transporter related |
|
|
|
|
|
|
|
|
|
|
|
|
ABC transporter related |
| Franean1_7255 |
|
|
|
|
|
|
|
Gene: Franean1_7255: ABC-3 protein |
|
|
|
|
|
|
|
|
|
|
|
|
ABC-3 protein |
| Franean1_7256 |
|
|
|
|
|
|
|
Gene: Franean1_7256: ABC-3 protein |
|
|
|
|
|
|
|
|
|
|
|
|
ABC-3 protein |
| Namu_1072 |
|
|
|
|
|
|
|
|
|
|
|
|
*
Nakamurella multipartita DSM 44233 Site: position = -28 score = 5.10015 sequence = TAACGAGAACCGTTCTCAGTA Gene: Namu_1072: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| CRON 8. | |||||||||||||||||||||
| znuA |
*
Acidothermus cellulolyticus 11B Site: position = -8 score = 4.67891 sequence = TACTTGCAATGATTTCCAACA Gene: Acel_2086: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Actinosynnema mirum DSM 43827 Site: position = -50 score = 4.26476 sequence = ACTCGACAACGGTTACCATTC Gene: Amir_0352: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Arth_2641: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
*
Brachybacterium faecium DSM 4810 Site: position = -8 score = 4.80844 sequence = TGGTGAGAATGATTGTCATGT Gene: Bfae_17080: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: BlinB01001749: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -37 score = 5.10264 sequence = TAGTGAGACTGGTTATCAATA Gene: CMM_2941: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
*
Janibacter sp. HTCC2649 Site: position = -39 score = 5.06336 sequence = AGTTGACAATCATTCTCAACT Site: position = -17 score = 5.14615 sequence = AGTTGAGAATGATTGTCATGA Gene: JNB_04825: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Kocuria rhizophila DC2201 Site: position = -63 score = 4.44609 sequence = TGATGACACTGATTCTCATCG Gene: KRH_09480: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Kytococcus sedentarius DSM 20547 Site: position = -17 score = 4.15706 sequence = ACCTGAGAATCATTGTCATGC Gene: Ksed_11830: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Leifsonia xyli subsp. xyli str. CTCB07 Site: position = -86 score = 5.55494 sequence = TTTTGACAATCATTATCAACA Gene: Lxx25040: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Namu_4923: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Nocardioides sp. JS614 Site: position = -30 score = 4.6031 sequence = GTTTGACAATCATTCTCAATC Site: position = -8 score = 4.32956 sequence = GGCTGAGAATGATTCTCATGA Gene: Noca_1937: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Propionibacterium acnes KPA171202 Site: position = -46 score = 4.66276 sequence = ATACGACAATGGTTATCACTT Gene: PPA0617: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Rhodococcus sp. RHA1 Site: position = -55 score = 4.82622 sequence = CAACGGTAACGGTTTCCAATA Gene: RHA1_ro04479: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Saccharomonospora viridis DSM 43017 Site: position = -90 score = 5.89675 sequence = TATCGAAAATCATTTCCAATA Gene: Svir_35300: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -69 score = 5.03586 sequence = ACATGACAACGGTTTCCGTTA Gene: SACE_0453: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Streptomyces coelicolor A3(2) Site: position = -39 score = 5.22508 sequence = TGTTGACAACGGTTTCCATAT Site: position = -17 score = 5.15991 sequence = TGTTGAAAATGAGTGTCATGA Gene: SCO2505: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| znuC |
Gene: Acel_2087: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Amir_0353: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Arth_2640: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -43 score = 5.41467 sequence = TATTGAGAACGATTGTCAGCA Gene: Blon_1757: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Bfae_17090: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: BlinB01001750: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: CMM_2940: Zinc ABC transporter, ATP-binding protein ZnuC |
|
Gene: JNB_04830: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: KRH_09490: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Ksed_11820: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Lxx25025: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Namu_4922: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Noca_1936: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: PPA0616: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: RHA1_ro04478: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Svir_35290: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: SACE_0452: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: SCO2506: Zinc ABC transporter, ATP-binding protein ZnuC |
|
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB |
Gene: Acel_2088: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Amir_0354: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Arth_2639: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
Gene: Bfae_17100: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: BlinB01001751: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: CMM_2939: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
Gene: JNB_04835: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: KRH_09500: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Ksed_11810: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Lxx25020: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Namu_4921: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Noca_1935: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: PPA0615: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: RHA1_ro04477: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Svir_35280: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: SACE_0451: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: SCO2507: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
| zur |
Gene: Acel_2085: Zinc uptake regulation protein Zur |
*2
Actinosynnema mirum DSM 43827 Gene: Amir_1261: Zinc uptake regulation protein Zur Site: position = -56 score = 5.30439 sequence = AATTGAAAACGATTGTCTTTT Gene: Amir_4413: Zinc uptake regulation protein Zur |
Gene: Arth_2638: Zinc uptake regulation protein Zur |
*2
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -45 score = 5.13933 sequence = TAACGATAATGAATATCATTT Gene: Blon_1974: Zinc uptake regulation protein Zur Gene: Blon_1979: Zinc uptake regulation protein Zur |
Gene: Bfae_17110: Zinc uptake regulation protein Zur |
*
Brevibacterium linens BL2 Site: position = -94 score = 5.73295 sequence = TAATGGTAACGTTTTTCATTA Gene: BlinB01002696: Zinc uptake regulation protein Zur |
Gene: CMM_2938: Zinc uptake regulation protein Zur |
*
Frankia sp. EAN1pec Site: position = -135 score = 5.34162 sequence = AAATGAAAACCGATGTCAACA Gene: Franean1_7263: Zinc uptake regulation protein Zur |
Gene: JNB_04840: Zinc uptake regulation protein Zur |
Gene: KRH_09520: Zinc uptake regulation protein Zur |
Gene: Ksed_11800: Zinc uptake regulation protein Zur |
Gene: Lxx25010: Zinc uptake regulation protein Zur |
Gene: Namu_0066: Zinc uptake regulation protein Zur |
Gene: Noca_1934: Zinc uptake regulation protein Zur |
Gene: PPA0948: Zinc uptake regulation protein Zur |
Gene: RHA1_ro01222: Zinc uptake regulation protein Zur |
Gene: Svir_13670: Zinc uptake regulation protein Zur |
Gene: SACE_1498: Zinc uptake regulation protein Zur |
Gene: SCO2508: Zinc uptake regulation protein Zur |
|
Zinc uptake regulation protein Zur |
| znuB2 |
Gene: Acel_2089: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
Gene: Blon_1758: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
| rpmB2 |
|
*
Actinosynnema mirum DSM 43827 Site: position = -40 score = 4.97159 sequence = AGGTGAAAATGATTGTCATTC Gene: Amir_0607: LSU ribosomal protein L28p |
|
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -37 score = 5.53349 sequence = ATTTGATAATGGTTATCATTA Gene: Blon_1965: LSU ribosomal protein L28p |
|
|
|
|
|
|
|
|
*
Nakamurella multipartita DSM 44233 Site: position = -127 score = 4.672 sequence = TAACGAGACCGATTCTCAGTA Gene: Namu_3856: LSU ribosomal protein L28p |
|
*
Propionibacterium acnes KPA171202 Site: position = -44 score = 4.97672 sequence = ATATGATAATGATTCTCATAT Gene: PPA2158: LSU ribosomal protein L28p |
*
Rhodococcus sp. RHA1 Site: position = -63 score = 5.40215 sequence = TGTCGAAAATGATTGTCATCA Site: position = -117 score = 5.41032 sequence = TTTCGATAACGATTGTCATTA Gene: RHA1_ro05617: LSU ribosomal protein L28p |
|
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -35 score = 5.46565 sequence = TAATGAAAACGGATGTCGTTA Gene: SACE_0754: LSU ribosomal protein L28p |
*
Streptomyces coelicolor A3(2) Site: position = -62 score = 5.60737 sequence = TACTGAAAATGAATTCCATTA Gene: SCO3429: LSU ribosomal protein L28p |
|
LSU ribosomal protein L28p |
| rpmG2 |
|
Gene: Amir_0606: LSU ribosomal protein L33p |
|
Gene: Blon_1966: LSU ribosomal protein L33p |
|
|
|
|
|
|
|
|
*
Nakamurella multipartita DSM 44233 Site: position = -44 score = 4.672 sequence = TACTGAGAATCGGTCTCGTTA Gene: Namu_3855: LSU ribosomal protein L33p |
|
Gene: PPA2160: LSU ribosomal protein L33p |
Gene: RHA1_ro05616: LSU ribosomal protein L33p |
|
Gene: SACE_0753: LSU ribosomal protein L33p |
*
Streptomyces coelicolor A3(2) Site: position = -31 score = 5.60737 sequence = TAATGGAATTCATTTTCAGTA Gene: SCO3428: LSU ribosomal protein L33p |
|
LSU ribosomal protein L33p |
| rpsN2 |
|
Gene: Amir_0605: SSU ribosomal protein S14p (S29e) |
|
Gene: Blon_1967: SSU ribosomal protein S14p (S29e) |
|
|
|
|
|
|
|
|
|
|
Gene: PPA2161: SSU ribosomal protein S14p (S29e) |
Gene: RHA1_ro05615: SSU ribosomal protein S14p (S29e) |
|
Gene: SACE_0752: SSU ribosomal protein S14p (S29e) |
Gene: SCO3430: SSU ribosomal protein S14p (S29e) |
|
SSU ribosomal protein S14p (S29e) |
| rpsR2 |
|
Gene: Amir_0604: SSU ribosomal protein S18p |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: RHA1_ro05614: SSU ribosomal protein S18p |
|
Gene: SACE_0751: SSU ribosomal protein S18p |
Gene: SCO3425: SSU ribosomal protein S18p |
|
SSU ribosomal protein S18p |
| rpmF2 |
|
Gene: Amir_4414: LSU ribosomal protein L32p |
|
Gene: Blon_1970: LSU ribosomal protein L32p |
|
|
|
|
|
|
|
|
|
|
Gene: PPA2162: LSU ribosomal protein L32p |
Gene: RHA1_ro05620: LSU ribosomal protein L32p |
|
Gene: SACE_0757: LSU ribosomal protein L32p |
*
Streptomyces coelicolor A3(2) Site: position = -56 score = 4.63956 sequence = ACATGAACATCGTTTTCATGT Gene: SCO0436: LSU ribosomal protein L32p |
|
LSU ribosomal protein L32p |
| rpmE2 |
|
Gene: Amir_4415: LSU ribosomal protein L31p |
|
Gene: Blon_1968: LSU ribosomal protein L31p |
|
|
|
|
|
|
|
|
|
|
*
Propionibacterium acnes KPA171202 Site: position = -73 score = 4.97672 sequence = ATATGAGAATCATTATCATAT Gene: PPA2157: LSU ribosomal protein L31p |
Gene: RHA1_ro05619: LSU ribosomal protein L31p |
|
Gene: SACE_0756: LSU ribosomal protein L31p |
Gene: SCO3427: LSU ribosomal protein L31p |
|
LSU ribosomal protein L31p |
| yciC |
|
*
Actinosynnema mirum DSM 43827 Site: position = -53 score = 5.52795 sequence = AAATGACAATCGTTTCCGTTA Gene: Amir_4416: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -12 score = 4.95307 sequence = AAATGAAAACCGTTGCCGACT Site: position = -66 score = 5.46565 sequence = TAACGACATCCGTTTTCATTA Gene: SACE_0755: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Gene: SCO3426: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
| SCE9.38 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: SCO3431: possible membrane protein |
|
possible membrane protein |
| RHA1_ro05618 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Rhodococcus sp. RHA1 Site: position = -29 score = 5.41032 sequence = TAATGACAATCGTTATCGAAA Site: position = -83 score = 5.40215 sequence = TGATGACAATCATTTTCGACA Gene: RHA1_ro05618: hypothetical protein |
|
|
|
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |