Regulon of Zur in Clavibacter michiganensis subsp. michiganensis NCPPB 382

Properties
Regulator type:	Transcription factor
TF locus tag:	CMM_2938
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Actinobacteria
Statistics of regulated genes:
- Genes	12
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5.1 Sequence: TAGTGAGACTGGTTATCAATA Locus tag: CMM_2941 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: CMM_2940 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: CMM_2939 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: CMM_2938 Name: zur Funciton: Zinc uptake regulation protein Zur
	CMM_2941	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	CMM_2940	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	CMM_2939	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	CMM_2938	zur	Zinc uptake regulation protein Zur
Position: -34 Score: 5 Sequence: TATTGAGAACCGTTCTCGTGA Locus tag: CMM_0025 Name: rpmJ2 Funciton: 50S ribosomal protein L36
	CMM_0025	rpmJ2	50S ribosomal protein L36
Position: -37 Score: 4.4 Sequence: GAATGAGAATGCTTATCAACT Locus tag: CMM_0174 Name: znuC4 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
	CMM_0174	znuC4	Zinc ABC transporter, ATP-binding protein ZnuC
Position: -32 Score: 4.2 Sequence: AGATGAGAACGGTTCTCTTCT Locus tag: CMM_0314 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	CMM_0314	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -31 Score: 5 Sequence: TCACGAGAACGGTTCTCAATA Locus tag: CMM_0026 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	CMM_0026	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -40 Score: 4.4 Sequence: AGTTGATAAGCATTCTCATTC Locus tag: CMM_0175 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: CMM_0176 Name: SCO00474 Funciton: WD40/YVTN repeat-like-containing domain Locus tag: CMM_0177 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: CMM_0178 Name: SCO0472 Funciton: WD40/YVTN repeat-like-containing domain
	CMM_0175	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	CMM_0176	SCO00474	WD40/YVTN repeat-like-containing domain
	CMM_0177	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	CMM_0178	SCO0472	WD40/YVTN repeat-like-containing domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD