Regulon of Zur in Janibacter sp. HTCC2649

Properties
Regulator type:	Transcription factor
TF locus tag:	JNB_04840
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Actinobacteria
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 5.1 Sequence: AGTTGACAATCATTCTCAACT Position: -17 Score: 5.1 Sequence: AGTTGAGAATGATTGTCATGA Locus tag: JNB_04825 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: JNB_04830 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: JNB_04835 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: JNB_04840 Name: zur Funciton: Zinc uptake regulation protein Zur
	JNB_04825	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	JNB_04830	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	JNB_04835	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	JNB_04840	zur	Zinc uptake regulation protein Zur

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD