Regulon of Zur in Actinosynnema mirum DSM 43827

Properties
Regulator type:	Transcription factor
TF locus tag:	Amir_1261, Amir_4413
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Actinobacteria
Statistics of regulated genes:
- Genes	20
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 5.6 Sequence: TATTGAAAATGATTGTCCTTT Locus tag: Amir_4776 Name: sapD Funciton: Conserved hypothetical protein CHP03773, ABC transporter-like Locus tag: Amir_4775 Name: null Funciton: hypothetical protein Locus tag: Amir_4774 Name: Amir_4774 Funciton: protein of unknown function DUF916 cell surface putative Locus tag: Amir_4773 Name: yciC3 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Amir_4776	sapD	Conserved hypothetical protein CHP03773, ABC transporter-like
	Amir_4775		hypothetical protein
	Amir_4774	Amir_4774	protein of unknown function DUF916 cell surface putative
	Amir_4773	yciC3	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -79 Score: 5.1 Sequence: GATTGAAAACGGTTGTCGTTT Locus tag: Amir_4768 Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Amir_4769 Name: null Funciton: hypothetical protein Locus tag: Amir_4770 Name: DIP0440 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Amir_4771 Name: DIP0441 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Amir_4768	troA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Amir_4769		hypothetical protein
	Amir_4770	DIP0440	Zinc ABC transporter, ATP-binding protein ZnuC
	Amir_4771	DIP0441	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -66 Score: 5.5 Sequence: AGTTGAAAACCGTTGTCATTT Locus tag: Amir_3101 Name: null Funciton: hypothetical protein
	Amir_3101		hypothetical protein
Position: -56 Score: 5.3 Sequence: AATTGAAAACGATTGTCTTTT Locus tag: Amir_4413 Name: zur Funciton: Zinc uptake regulation protein Zur
	Amir_4413	zur	Zinc uptake regulation protein Zur
Position: -50 Score: 4.3 Sequence: ACTCGACAACGGTTACCATTC Locus tag: Amir_0352 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Amir_0353 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Amir_0354 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Amir_0352	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Amir_0353	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Amir_0354	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -40 Score: 5 Sequence: AGGTGAAAATGATTGTCATTC Locus tag: Amir_0607 Name: rpmB2 Funciton: LSU ribosomal protein L28p Locus tag: Amir_0606 Name: rpmG2 Funciton: LSU ribosomal protein L33p Locus tag: Amir_0605 Name: rpsN2 Funciton: SSU ribosomal protein S14p (S29e) Locus tag: Amir_0604 Name: rpsR2 Funciton: SSU ribosomal protein S18p
	Amir_0607	rpmB2	LSU ribosomal protein L28p
	Amir_0606	rpmG2	LSU ribosomal protein L33p
	Amir_0605	rpsN2	SSU ribosomal protein S14p (S29e)
	Amir_0604	rpsR2	SSU ribosomal protein S18p
Position: -53 Score: 5.5 Sequence: AAATGACAATCGTTTCCGTTA Locus tag: Amir_4416 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: Amir_4415 Name: rpmE2 Funciton: LSU ribosomal protein L31p Locus tag: Amir_4414 Name: rpmF2 Funciton: LSU ribosomal protein L32p
	Amir_4416	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Amir_4415	rpmE2	LSU ribosomal protein L31p
	Amir_4414	rpmF2	LSU ribosomal protein L32p

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Actinosynnema mirum DSM 43827

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --