Regulon of Zur in Kocuria rhizophila DC2201

Properties
Regulator type:	Transcription factor
TF locus tag:	KRH_09520
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Actinobacteria
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 4.4 Sequence: TGATGACACTGATTCTCATCG Locus tag: KRH_09480 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: KRH_09490 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: KRH_09500 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	KRH_09480	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	KRH_09490	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	KRH_09500	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -120 Score: 5.3 Sequence: TAACGAGAACCGTTATCATTT Locus tag: KRH_17300 Name: null Funciton: hypothetical protein Locus tag: KRH_17290 Name: null Funciton: hypothetical protein Locus tag: KRH_17280 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	KRH_17300		hypothetical protein
	KRH_17290		hypothetical protein
	KRH_17280	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -83 Score: 4.5 Sequence: AGATAAAAACGATTCTCATCT Locus tag: KRH_00820 Name: SCO0472 Funciton: WD40/YVTN repeat-like-containing domain Locus tag: KRH_00830 Name: SCO0472 Funciton: WD40/YVTN repeat-like-containing domain
	KRH_00820	SCO0472	WD40/YVTN repeat-like-containing domain
	KRH_00830	SCO0472	WD40/YVTN repeat-like-containing domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD