Regulon of Zur in Arthrobacter sp. FB24

Properties
Regulator type:	Transcription factor
TF locus tag:	Arth_2638
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Actinobacteria
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -2 Score: 5.2 Sequence: AAATGAGAATGATTCTCATAT Locus tag: Arth_3252 Name: null Funciton: hypothetical protein Locus tag: Arth_3253 Name: null Funciton: hypothetical protein Locus tag: Arth_3254 Name: rpmJ2 Funciton: 50S ribosomal protein L36
	Arth_3252		hypothetical protein
	Arth_3253		hypothetical protein
	Arth_3254	rpmJ2	50S ribosomal protein L36
Position: -26 Score: 5.2 Sequence: TAATGAGAATGACTATCATTT Locus tag: Arth_4108 Name: SCO0472 Funciton: WD40/YVTN repeat-like-containing domain
	Arth_4108	SCO0472	WD40/YVTN repeat-like-containing domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD