Regulon of Zur in Acidothermus cellulolyticus 11B

Properties
Regulator type:	Transcription factor
TF locus tag:	Acel_2085
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Actinobacteria
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -8 Score: 4.7 Sequence: TACTTGCAATGATTTCCAACA Locus tag: Acel_2086 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Acel_2087 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Acel_2088 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Acel_2089 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Acel_2086	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Acel_2087	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Acel_2088	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Acel_2089	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD