Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulon of Zur in Acidothermus cellulolyticus 11B

Properties
Regulator type: Transcription factor
TF locus tag: Acel_2085
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Actinobacteria
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -8
Score: 4.7
Sequence: TACTTGCAATGATTTCCAACA
Locus tag: Acel_2086
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Acel_2087
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Acel_2088
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Acel_2089
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuB2
Zinc ABC transporter, inner membrane permease protein ZnuB
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD