Regulon of Zur in Propionibacterium acnes KPA171202

Properties
Regulator type:	Transcription factor
TF locus tag:	PPA0948
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Actinobacteria
Statistics of regulated genes:
- Genes	13
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.3 Sequence: AATCGATAACCGTTCTCATTA Locus tag: PPA1500 Name: sapD Funciton: Conserved hypothetical protein CHP03773, ABC transporter-like Locus tag: PPA1501 Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: PPA1502 Name: DIP0439 Funciton: Surface-anchored repeat, actinobacteria Locus tag: PPA1503 Name: DIP0440 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PPA1504 Name: DIP0441 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	PPA1500	sapD	Conserved hypothetical protein CHP03773, ABC transporter-like
	PPA1501	troA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	PPA1502	DIP0439	Surface-anchored repeat, actinobacteria
	PPA1503	DIP0440	Zinc ABC transporter, ATP-binding protein ZnuC
	PPA1504	DIP0441	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -44 Score: 5 Sequence: ATATGATAATGATTCTCATAT Locus tag: PPA2158 Name: rpmB2 Funciton: LSU ribosomal protein L28p Locus tag: PPA2160 Name: rpmG2 Funciton: LSU ribosomal protein L33p Locus tag: PPA2161 Name: rpsN2 Funciton: SSU ribosomal protein S14p (S29e) Locus tag: PPA2162 Name: rpmF2 Funciton: LSU ribosomal protein L32p
	PPA2158	rpmB2	LSU ribosomal protein L28p
	PPA2160	rpmG2	LSU ribosomal protein L33p
	PPA2161	rpsN2	SSU ribosomal protein S14p (S29e)
	PPA2162	rpmF2	LSU ribosomal protein L32p
Position: -46 Score: 4.7 Sequence: ATACGACAATGGTTATCACTT Locus tag: PPA0617 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: PPA0616 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PPA0615 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	PPA0617	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	PPA0616	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	PPA0615	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -73 Score: 5 Sequence: ATATGAGAATCATTATCATAT Locus tag: PPA2157 Name: rpmE2 Funciton: LSU ribosomal protein L31p
	PPA2157	rpmE2	LSU ribosomal protein L31p

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD