Regulon of Zur in Brevibacterium linens BL2

Properties
Regulator type:	Transcription factor
TF locus tag:	BlinB01002696
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Actinobacteria
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -94 Score: 5.7 Sequence: TAATGGTAACGTTTTTCATTA Locus tag: BlinB01002696 Name: zur Funciton: Zinc uptake regulation protein Zur
	BlinB01002696	zur	Zinc uptake regulation protein Zur
Position: -60 Score: 5.7 Sequence: TAATGAAAAACGTTACCATTA Locus tag: BlinB01002695 Name: yciC4 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	BlinB01002695	yciC4	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -56 Score: 4.8 Sequence: TATTGAGAACGAGTATTATTA Locus tag: BlinB01002697 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	BlinB01002697	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -31 Score: 5.4 Sequence: CAATGAGAACCATTATCAATA Locus tag: BlinB01002691 Name: SCO00474 Funciton: WD40/YVTN repeat-like-containing domain Locus tag: BlinB01002690 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: BlinB01002689 Name: SCO0472 Funciton: WD40/YVTN repeat-like-containing domain
	BlinB01002691	SCO00474	WD40/YVTN repeat-like-containing domain
	BlinB01002690	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	BlinB01002689	SCO0472	WD40/YVTN repeat-like-containing domain
Position: -25 Score: 4.7 Sequence: TAACAATAATGGTTATCATCA Locus tag: BlinB01002692 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	BlinB01002692	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD