Regulon of Zur in Frankia sp. EAN1pec

Properties
Regulator type:	Transcription factor
TF locus tag:	Franean1_7263
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Actinobacteria
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -135 Score: 5.3 Sequence: AAATGAAAACCGATGTCAACA Locus tag: Franean1_7263 Name: zur Funciton: Zinc uptake regulation protein Zur
	Franean1_7263	zur	Zinc uptake regulation protein Zur
Position: -26 Score: 5.1 Sequence: CATCGACAACCGTTTTCATTT Locus tag: Franean1_7253 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Franean1_7254 Name: null Funciton: ABC transporter related Locus tag: Franean1_7255 Name: null Funciton: ABC-3 protein Locus tag: Franean1_7256 Name: null Funciton: ABC-3 protein
	Franean1_7253	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Franean1_7254		ABC transporter related
	Franean1_7255		ABC-3 protein
	Franean1_7256		ABC-3 protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD