Regulog PaaR - Actinobacteria
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Phenylacetic acid degradation |
| Effector: | Phenylacetyl-CoA |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - PaaR
- By TF family - TetR
- By effector - Phenylacetyl-CoA
- By pathway - Phenylacetic acid degradation
| Genome | Genes | Operons |
|---|---|---|
| Acidothermus cellulolyticus 11B | 6 | 2 |
| Arthrobacter chlorophenolicus A6 | 15 | 6 |
| Arthrobacter sp. FB24 | 14 | 6 |
| Brevibacterium linens BL2 | 11 | 3 |
| Corynebacterium efficiens YS-314 | 17 | 7 |
| Kocuria rhizophila DC2201 | 15 | 5 |
| Mycobacterium abscessus ATCC 19977 | 13 | 4 |
| Nakamurella multipartita DSM 44233 | 9 | 2 |
| Nocardia farcinica IFM 10152 | 14 | 3 |
| Rhodococcus erythropolis PR4 | 14 | 5 |
| Rhodococcus opacus B4 | 15 | 5 |
| Rhodococcus sp. RHA1 | 15 | 5 |
| Saccharomonospora viridis DSM 43017 | 10 | 3 |
| Saccharopolyspora erythraea NRRL 2338 | 8 | 2 |
| Streptomyces avermitilis MA-4680 | 12 | 5 |
| Streptomyces coelicolor A3(2) | 13 | 5 |
| Streptomyces griseus subsp. griseus NBRC 13350 | 11 | 5 |
| Genes | Function | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||||
| bkdA |
|
Gene: Achl_2905: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) |
Gene: Arth_3193: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) |
Gene: BlinB01003357: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) |
|
Gene: KRH_21250: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) |
|
|
|
|
|
|
|
Gene: SACE_5542: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) |
*
Streptomyces avermitilis MA-4680 Site: position = -77 score = 5.51192 sequence = GACGACCGAACAATCGGTAGGT Gene: SAV_4362: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) |
*
Streptomyces coelicolor A3(2) Site: position = -78 score = 5.51192 sequence = GACGACCGAACAATCGGTAGGT Gene: SCO3831: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -127 score = 5.59169 sequence = CGCGACCGAACAATCGGTAGGT Gene: SGR_3748: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) |
Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) |
| bkdB |
|
Gene: Achl_2904: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) |
Gene: Arth_3192: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) |
Gene: BlinB01003356: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) |
|
Gene: KRH_21260: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) |
|
|
|
|
|
|
|
Gene: SACE_5543: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) |
Gene: SAV_4363: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) |
Gene: SCO3830: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) |
Gene: SGR_3749: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) |
Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) |
| bkdC |
|
Gene: Achl_2903: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) |
Gene: Arth_3191: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) |
Gene: BlinB01003355: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) |
|
Gene: KRH_21270: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) |
|
|
|
|
|
|
|
Gene: SACE_5544: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) |
Gene: SAV_4364: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) |
Gene: SCO3829: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) |
Gene: SGR_3750: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) |
Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) |
| CRON 2. | ||||||||||||||||||
| hisE |
|
Gene: Achl_1674: phosphoribosyl-ATP diphosphatase |
Gene: Arth_1679: phosphoribosyl-ATP diphosphatase |
Gene: BlinB01000126: phosphoribosyl-ATP diphosphatase |
*
Corynebacterium efficiens YS-314 Site: position = -23 score = 5.13982 sequence = AACAACCGCACGATCGGTATGT Gene: CE1635: phosphoribosyl-ATP diphosphatase |
Gene: KRH_11730: phosphoribosyl-ATP diphosphatase |
Gene: MAB_2131: phosphoribosyl-ATP diphosphatase |
Gene: Namu_2980: phosphoribosyl-ATP diphosphatase |
Gene: nfa31860: phosphoribosyl-ATP diphosphatase |
Gene: RER_31850: phosphoribosyl-ATP diphosphatase |
Gene: ROP_05930: phosphoribosyl-ATP diphosphatase |
Gene: RHA1_ro00855: phosphoribosyl-ATP diphosphatase |
Gene: Svir_22180: phosphoribosyl-ATP diphosphatase |
Gene: SACE_2237: phosphoribosyl-ATP diphosphatase |
Gene: SAV_6906: phosphoribosyl-ATP diphosphatase |
Gene: SCO1439: phosphoribosyl-ATP diphosphatase |
Gene: SGR_6094: phosphoribosyl-ATP diphosphatase |
phosphoribosyl-ATP diphosphatase |
| hisG |
Gene: Acel_1270: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: Achl_1675: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: Arth_1680: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: BlinB01000125: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: CE1634: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: KRH_11740: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: MAB_2132: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: Namu_2979: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: nfa31850: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: RER_31840: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: ROP_05920: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: RHA1_ro00854: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: Svir_22170: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: SACE_2238: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: SAV_6907: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: SCO1438: ATP phosphoribosyltransferase (EC 2.4.2.17) |
Gene: SGR_6095: ATP phosphoribosyltransferase (EC 2.4.2.17) |
ATP phosphoribosyltransferase (EC 2.4.2.17) |
| CRON 3. | ||||||||||||||||||
| paaJ |
|
*
Arthrobacter chlorophenolicus A6 Site: position = -83 score = 6.06424 sequence = ACAGAACGAACGGTCGGTAAGT Gene: Achl_3063: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
*
Arthrobacter sp. FB24 Site: position = -83 score = 5.38954 sequence = ATAGAACGAACGGTCGGTAAAT Gene: Arth_3268: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
Gene: BlinB01000727: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
Gene: CE0673: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
Gene: KRH_02300: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
*
Mycobacterium abscessus ATCC 19977 Site: position = -44 score = 6.19901 sequence = ACCGACCGAACGATCGGTTATT Gene: MAB_0902: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
|
*
Nocardia farcinica IFM 10152 Site: position = -49 score = 5.81919 sequence = ACTGACCGAATGTTCGGTAATA Gene: nfa21570: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
|
*
Rhodococcus opacus B4 Site: position = -148 score = 5.14428 sequence = TTTCACCGTACGTTCGGTCGGT Site: position = -53 score = 5.33985 sequence = ACCGACCGAAGATTCGGTTATT Gene: ROP_25860: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
*
Rhodococcus sp. RHA1 Site: position = -149 score = 5.14428 sequence = TTTCACCGTACGTTCGGTCGGT Site: position = -53 score = 5.33985 sequence = ACCGACCGAAGATTCGGTTATT Gene: RHA1_ro02863: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
|
|
|
|
|
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
| paaF |
|
Gene: Achl_3062: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Arth_3267: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: BlinB01000728: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: CE0674: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: KRH_02290: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: MAB_0903: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
Gene: nfa21580: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Rhodococcus erythropolis PR4 Site: position = 29 score = 5.68047 sequence = AACGACCGAATGTTCGGTTATT Gene: RER_55530: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: ROP_25850: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: RHA1_ro02862: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
|
|
|
|
Enoyl-CoA hydratase (EC 4.2.1.17) |
| paaH |
Gene: Acel_0147: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: Achl_3061: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: Arth_3266: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: BlinB01000729: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: CE0675: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: KRH_02280: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: MAB_0904: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: Namu_2482: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: nfa21590: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: RER_55520: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: ROP_25840: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: RHA1_ro02861: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
*
Saccharomonospora viridis DSM 43017 Site: position = -116 score = 5.74761 sequence = ACTGACCGAATGGACGGTTACT Gene: Svir_26550: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
|
*
Streptomyces avermitilis MA-4680 Site: position = -74 score = 6.04741 sequence = AGTAACCGAACGATCGGTCGGG Gene: SAV_4359: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
*
Streptomyces coelicolor A3(2) Site: position = -74 score = 6.04741 sequence = AGTAACCGAACGATCGGTCGGG Gene: SCO3834: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
|
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
| paaG |
Gene: Acel_1836: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Achl_2959: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Arth_3213: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: BlinB01000730: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: CE0672: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: KRH_02100: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: MAB_0905: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Namu_2150: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: nfa21600: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: RER_55510: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: ROP_25830: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: RHA1_ro02860: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Svir_06370: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: SACE_1028: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: SAV_3120: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: SCO5144: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: SGR_2381: Enoyl-CoA hydratase (EC 4.2.1.17) |
Enoyl-CoA hydratase (EC 4.2.1.17) |
| paaA |
*
Acidothermus cellulolyticus 11B Site: position = -41 score = 5.34778 sequence = GTCAACCGAACATTCGGTCGGT Gene: Acel_1443: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Arthrobacter chlorophenolicus A6 Site: position = -64 score = 5.82946 sequence = CCTGAACGAACGGTCGGTAAAT Gene: Achl_2964: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Arthrobacter sp. FB24 Site: position = -49 score = 5.88382 sequence = CCTGAACGAACGGTCGGTAATT Gene: Arth_3218: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Brevibacterium linens BL2 Site: position = -105 score = 4.50547 sequence = CAATACAGAACAAATGGTCAGT Gene: BlinB01000722: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Corynebacterium efficiens YS-314 Site: position = -128 score = 6.07241 sequence = ACTGACCGGGCGGTCGGTTAGT Gene: CE0667: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Kocuria rhizophila DC2201 Site: position = -210 score = 5.57424 sequence = ATTTTCAGAACGATCGGTCAGT Site: position = -67 score = 5.00629 sequence = TCTGAACGAGCGGTCAGTTATT Gene: KRH_02150: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Mycobacterium abscessus ATCC 19977 Site: position = -37 score = 6.17773 sequence = AATAACCGAACATTCGGTCGGT Gene: MAB_0906: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Nakamurella multipartita DSM 44233 Site: position = -70 score = 6.0197 sequence = TCTTACTGACCGTTCGGTCAGT Gene: Namu_2491: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: nfa21610: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Rhodococcus erythropolis PR4 Site: position = -35 score = 5.03299 sequence = ACCAACCGATCATTCGGTAATA Gene: RER_55500: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Rhodococcus opacus B4 Site: position = 23 score = 5.03299 sequence = ACCAACCGATCATTCGGTAATA Gene: ROP_25820: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Rhodococcus sp. RHA1 Site: position = -34 score = 5.03299 sequence = ACCAACCGATCATTCGGTAATA Gene: RHA1_ro02859: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: Svir_26530: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: SACE_3544: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Streptomyces avermitilis MA-4680 Site: position = -52 score = 5.93709 sequence = GCGAACCGAACGATCGGTCGGT Gene: SAV_4354: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Streptomyces coelicolor A3(2) Site: position = -157 score = 5.27229 sequence = CCCGACCGACCATTCGGTTAGC Site: position = -34 score = 5.31018 sequence = ACCGAACGAATGGTCGGTTGGG Gene: SCO7471: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -34 score = 6.14672 sequence = AGGAACCGAACGATCGGTCGGT Gene: SGR_3741: Phenylacetate-CoA oxygenase, PaaA subunit |
Phenylacetate-CoA oxygenase, PaaA subunit |
| paaB |
Gene: Acel_1442: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Achl_2963: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Arth_3217: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: BlinB01000723: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: CE0668: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: KRH_02140: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: MAB_0907: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Namu_2490: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: nfa21620: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: RER_55490: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: ROP_25810: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: RHA1_ro02858: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Svir_26520: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: SACE_3545: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: SAV_4353: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: SCO7472: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: SGR_3740: Phenylacetate-CoA oxygenase, PaaB subunit |
Phenylacetate-CoA oxygenase, PaaB subunit |
| paaC |
Gene: Acel_1441: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Achl_2962: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Arth_3216: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: BlinB01000724: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: CE0669: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: KRH_02130: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: MAB_0908: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Namu_2489: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: nfa21630: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: RER_55480: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: ROP_25800: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: RHA1_ro02857: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Svir_26510: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: SACE_3546: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: SAV_4352: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: SCO7473: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: SGR_3739: Phenylacetate-CoA oxygenase, PaaC subunit |
Phenylacetate-CoA oxygenase, PaaC subunit |
| paaD |
Gene: Acel_1440: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Achl_2961: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Arth_3215: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: BlinB01000725: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: CE0670: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: KRH_02120: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: MAB_0909: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Namu_2488: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: nfa21640: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: RER_55470: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: ROP_25790: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: RHA1_ro02856: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Svir_26500: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: SACE_3547: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: SAV_4351: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: SCO7474: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: SGR_3738: Phenylacetate-CoA oxygenase, PaaD subunit |
Phenylacetate-CoA oxygenase, PaaD subunit |
| paaE |
Gene: Acel_1439: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Achl_2960: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Arth_3214: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: BlinB01000726: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: CE0671: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: KRH_02110: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: MAB_0910: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Namu_2487: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: nfa21650: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: RER_55460: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: ROP_25780: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: RHA1_ro02855: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Svir_26490: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: SACE_3548: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: SAV_4350: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: SCO7475: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: SGR_3737: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
| paaK |
|
Gene: Achl_3048: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Arth_3247: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: BlinB01000720: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
*
Corynebacterium efficiens YS-314 Site: position = -176 score = 5.43404 sequence = ACTTACCGACTGGTCAGTTGGT Gene: CE0663: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: KRH_02170: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: MAB_0911: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
|
Gene: nfa21660: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: RER_55450: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: ROP_25770: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: RHA1_ro02854: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Svir_26570: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -232 score = 5.18149 sequence = TTTTACCGACCGTTCGTTCGGT Site: position = -94 score = 5.48238 sequence = AATAACCGACTACTCGGTCAGT Gene: SACE_3542: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
*
Streptomyces avermitilis MA-4680 Site: position = -56 score = 4.6858 sequence = GGCTACCGAATGATCGGTCGCC Gene: SAV_1257: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: SCO7469: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -77 score = 4.96859 sequence = ATCGACCGAATGATCGGTCGCC Gene: SGR_6814: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
| paaZ |
*
Acidothermus cellulolyticus 11B Site: position = -177 score = 4.86841 sequence = GCCGACCGAACGTTCGGTCTAG Gene: Acel_1435: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Arthrobacter chlorophenolicus A6 Site: position = -82 score = 6.04604 sequence = TATTACCGAACGGACGGTCAGT Gene: Achl_3053: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Arthrobacter sp. FB24 Site: position = -72 score = 6.04604 sequence = TATTACCGAACGGACGGTCAGT Gene: Arth_3255: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Brevibacterium linens BL2 Site: position = -101 score = 5.88031 sequence = AATAACCGACCGATTGGTTAGT Gene: BlinB01000711: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Corynebacterium efficiens YS-314 Site: position = -121 score = 5.78983 sequence = ACTGACCGGCCGTTCGGTAACT Gene: CE0677: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Kocuria rhizophila DC2201 Site: position = -48 score = 4.80935 sequence = ACTGACCGATCGTTCGGCTAAC Gene: KRH_02200: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Mycobacterium abscessus ATCC 19977 Site: position = -35 score = 5.43532 sequence = ACCGAACGAATGGACGGTTGGT Gene: MAB_0900c: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
Gene: Namu_2485: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Nocardia farcinica IFM 10152 Site: position = -36 score = 5.09163 sequence = AATTACCGACCGAATGTTCAGT Gene: nfa21550: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Rhodococcus erythropolis PR4 Site: position = -32 score = 5.42981 sequence = ACCGACCGAACGTACGGTGAGA Gene: RER_55550: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Rhodococcus opacus B4 Site: position = -127 score = 5.56083 sequence = AATAACCGAATCTTCGGTCGGT Site: position = -32 score = 5.11525 sequence = ACCGACCGAACGTACGGTGAAA Gene: ROP_25870: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Rhodococcus sp. RHA1 Site: position = -32 score = 5.11525 sequence = ACCGACCGAACGTACGGTGAAA Site: position = -128 score = 5.56083 sequence = AATAACCGAATCTTCGGTCGGT Gene: RHA1_ro02864: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Saccharomonospora viridis DSM 43017 Site: position = -39 score = 5.74156 sequence = ACTTCCTGAACGTTCGGTTGGT Gene: Svir_26540: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -186 score = 5.62814 sequence = ACTGACCGAGTAGTCGGTTATT Site: position = -52 score = 5.83397 sequence = CGTTACCGAACGAACGGTCGGT Gene: SACE_3543: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Streptomyces avermitilis MA-4680 Site: position = -96 score = 5.16879 sequence = CCCGACCGATCGTTCGGTTACT Gene: SAV_4358: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Streptomyces coelicolor A3(2) Site: position = -106 score = 5.16879 sequence = CCCGACCGATCGTTCGGTTACT Gene: SCO3835: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -72 score = 5.16879 sequence = CCCGACCGATCGTTCGGTTACT Gene: SGR_3745: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
| paaT |
|
*
Arthrobacter chlorophenolicus A6 Site: position = -73 score = 5.28592 sequence = ACCAACTGACCGTTCTGTCGGT Gene: Achl_2302: Predicted phylacetic acid transporter PaaT |
*
Arthrobacter sp. FB24 Site: position = -87 score = 5.52782 sequence = ACTGACCGTTCGATCGGTAATT Gene: Arth_2568: Predicted phylacetic acid transporter PaaT |
*
Brevibacterium linens BL2 Site: position = -191 score = 5.28281 sequence = ACTAACCAATCGGTCGGTTATT Gene: BlinB01000710: Predicted phylacetic acid transporter PaaT |
Gene: CE0662: Predicted phylacetic acid transporter PaaT |
*
Kocuria rhizophila DC2201 Site: position = -85 score = 4.76001 sequence = ACGTCAAGACCAATCGGTCGGT Gene: KRH_02310: Predicted phylacetic acid transporter PaaT |
|
|
|
*
Rhodococcus erythropolis PR4 Site: position = -178 score = 4.60944 sequence = ACCTACCGATCATTCGGTTGCC Gene: RER_44780: Predicted phylacetic acid transporter PaaT |
*
Rhodococcus opacus B4 Site: position = -122 score = 5.49122 sequence = ACCAACCGAACGTACGGTTATA Site: position = -39 score = 5.40443 sequence = CCTGACCGAACAATCGGTCGAG Gene: ROP_17540: Predicted phylacetic acid transporter PaaT |
*
Rhodococcus sp. RHA1 Site: position = -124 score = 5.49122 sequence = ACCAACCGAACGTACGGTTATA Site: position = -40 score = 4.80433 sequence = CCTGACCGAACAGTCGTTCGCA Gene: RHA1_ro02082: Predicted phylacetic acid transporter PaaT |
Gene: Svir_18260: Predicted phylacetic acid transporter PaaT |
|
|
|
|
Predicted phylacetic acid transporter PaaT |
| ethD |
|
|
|
|
|
|
Gene: MAB_0899c: Possible ethyl tert-butyl ether degradation protein EthD |
|
Gene: nfa21540: Possible ethyl tert-butyl ether degradation protein EthD |
Gene: RER_55560: Possible ethyl tert-butyl ether degradation protein EthD |
Gene: ROP_25880: Possible ethyl tert-butyl ether degradation protein EthD |
Gene: RHA1_ro02865: Possible ethyl tert-butyl ether degradation protein EthD |
|
|
|
|
|
Possible ethyl tert-butyl ether degradation protein EthD |
| paaI |
Gene: Acel_1660: Phenylacetic acid degradation protein PaaI, thioesterase |
*
Arthrobacter chlorophenolicus A6 Site: position = -42 score = 5.25667 sequence = ACCTAATGAACATTCGGTAAAT Gene: Achl_3047: Phenylacetic acid degradation protein PaaI, thioesterase |
*
Arthrobacter sp. FB24 Site: position = -42 score = 5.25667 sequence = ACCTAATGAACATTCGGTAAAT Gene: Arth_3246: Phenylacetic acid degradation protein PaaI, thioesterase |
Gene: BlinB01000721: Phenylacetic acid degradation protein PaaI, thioesterase |
*
Corynebacterium efficiens YS-314 Site: position = -58 score = 5.09696 sequence = TACTACCGTCCATTCGGTAAGT Gene: CE0666: Phenylacetic acid degradation protein PaaI, thioesterase |
*
Kocuria rhizophila DC2201 Site: position = -38 score = 4.65102 sequence = ACTGACCGATCGTTCTGAAAAT Site: position = -181 score = 4.79563 sequence = AATAACTGACCGCTCGTTCAGA Gene: KRH_02160: Phenylacetic acid degradation protein PaaI, thioesterase |
|
Gene: Namu_2481: Phenylacetic acid degradation protein PaaI, thioesterase |
Gene: nfa21530: Phenylacetic acid degradation protein PaaI, thioesterase |
Gene: RER_55570: Phenylacetic acid degradation protein PaaI, thioesterase |
Gene: ROP_25890: Phenylacetic acid degradation protein PaaI, thioesterase |
Gene: RHA1_ro02866: Phenylacetic acid degradation protein PaaI, thioesterase |
*
Saccharomonospora viridis DSM 43017 Site: position = -42 score = 5.73763 sequence = AGTAACCGTCCATTCGGTCAGT Gene: Svir_26560: Phenylacetic acid degradation protein PaaI, thioesterase |
|
|
*
Streptomyces coelicolor A3(2) Site: position = -152 score = 5.01265 sequence = CCCAACCGACCATTCGTTCGGT Site: position = -29 score = 5.54906 sequence = GCTAACCGAATGGTCGGTCGGG Gene: SCO7470: Phenylacetic acid degradation protein PaaI, thioesterase |
|
Phenylacetic acid degradation protein PaaI, thioesterase |
| paaR |
Gene: Acel_1436: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: Achl_3049: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: Arth_3248: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: BlinB01000719: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Corynebacterium efficiens YS-314 Site: position = -599 score = 5.61864 sequence = ACTAACCGACCGCCCGGTCAGT Gene: CE0665: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: KRH_02180: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Mycobacterium abscessus ATCC 19977 Site: position = -92 score = 5.87975 sequence = AATAACCGATCGTTCGGTCGGT Gene: MAB_0901c: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Nakamurella multipartita DSM 44233 Site: position = -43 score = 6.14096 sequence = ACTGACCGAATGATCGGTCAGC Gene: Namu_2483: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Nocardia farcinica IFM 10152 Site: position = -81 score = 6.05123 sequence = TATTACCGAACATTCGGTCAGT Gene: nfa21560: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Rhodococcus erythropolis PR4 Site: position = -80 score = 5.91754 sequence = AATAACCGAACATTCGGTCGTT Gene: RER_55540: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Rhodococcus opacus B4 Site: position = -80 score = 4.63114 sequence = CTGAACCGAACCTTCGGTCGGC Gene: ROP_23860: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Rhodococcus sp. RHA1 Site: position = -80 score = 4.73987 sequence = TTCAACCGAACCTTCGGTCGGC Gene: RHA1_ro02633: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: Svir_26580: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: SACE_3541: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: SAV_4360: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: SCO3833: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -106 score = 6.04741 sequence = AGTAACCGAACGATCGGTCGGG Gene: SGR_3746: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Transcriptional regulator of phenylacetic acid degradation, TetR family |
| paaY |
|
*
Arthrobacter chlorophenolicus A6 Site: position = -66 score = 5.5101 sequence = ACTGACCGTCCGTTCGGTAATA Gene: Achl_3054: thioesterase superfamily protein |
*
Arthrobacter sp. FB24 Site: position = -128 score = 5.5101 sequence = ACTGACCGTCCGTTCGGTAATA Gene: Arth_3256: thioesterase superfamily protein |
|
*
Corynebacterium efficiens YS-314 Site: position = -47 score = 6.01934 sequence = AGTTACCGAACGGCCGGTCAGT Gene: CE0676: thioesterase superfamily protein |
*
Kocuria rhizophila DC2201 Site: position = -268 score = 5.46504 sequence = GTTAGCCGAACGATCGGTCAGT Gene: KRH_02210: thioesterase superfamily protein |
|
|
|
|
|
|
|
|
|
|
|
thioesterase superfamily protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |