Regulon of PaaR in Mycobacterium abscessus ATCC 19977

Properties
Regulator type:	Transcription factor
TF locus tag:	MAB_0901c
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Actinobacteria
Statistics of regulated genes:
- Genes	13
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.2 Sequence: AATAACCGAACATTCGGTCGGT Locus tag: MAB_0906 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: MAB_0907 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: MAB_0908 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: MAB_0909 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: MAB_0910 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: MAB_0911 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	MAB_0906	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	MAB_0907	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	MAB_0908	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	MAB_0909	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	MAB_0910	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	MAB_0911	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -44 Score: 6.2 Sequence: ACCGACCGAACGATCGGTTATT Locus tag: MAB_0902 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: MAB_0903 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: MAB_0904 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: MAB_0905 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	MAB_0902	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	MAB_0903	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	MAB_0904	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	MAB_0905	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -35 Score: 5.4 Sequence: ACCGAACGAATGGACGGTTGGT Locus tag: MAB_0900c Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: MAB_0899c Name: ethD Funciton: Possible ethyl tert-butyl ether degradation protein EthD
	MAB_0900c	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	MAB_0899c	ethD	Possible ethyl tert-butyl ether degradation protein EthD
Position: -92 Score: 5.9 Sequence: AATAACCGATCGTTCGGTCGGT Locus tag: MAB_0901c Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	MAB_0901c	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD