Regulon of PaaR in Nakamurella multipartita DSM 44233

Properties
Regulator type:	Transcription factor
TF locus tag:	Namu_2483
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Actinobacteria
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 6.1 Sequence: ACTGACCGAATGATCGGTCAGC Locus tag: Namu_2483 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family Locus tag: Namu_2482 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: Namu_2481 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase
	Namu_2483	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
	Namu_2482	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	Namu_2481	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
Position: -70 Score: 6 Sequence: TCTTACTGACCGTTCGGTCAGT Locus tag: Namu_2491 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Namu_2490 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Namu_2489 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Namu_2488 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Namu_2487 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Namu_2485 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Namu_2491	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Namu_2490	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Namu_2489	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Namu_2488	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Namu_2487	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Namu_2485	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD