Regulon of PaaR in Saccharomonospora viridis DSM 43017

Properties
Regulator type:	Transcription factor
TF locus tag:	Svir_26580
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Actinobacteria
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 5.7 Sequence: AGTAACCGTCCATTCGGTCAGT Locus tag: Svir_26560 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase Locus tag: Svir_26570 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Svir_26580 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	Svir_26560	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
	Svir_26570	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Svir_26580	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -39 Score: 5.7 Sequence: ACTTCCTGAACGTTCGGTTGGT Locus tag: Svir_26540 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: Svir_26530 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Svir_26520 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Svir_26510 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Svir_26500 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Svir_26490 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Svir_26540	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Svir_26530	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Svir_26520	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Svir_26510	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Svir_26500	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Svir_26490	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Position: -116 Score: 5.7 Sequence: ACTGACCGAATGGACGGTTACT Locus tag: Svir_26550 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	Svir_26550	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD