Regulon of PaaR in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type:	Transcription factor
TF locus tag:	SGR_3746
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Actinobacteria
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -106 Score: 6 Sequence: AGTAACCGAACGATCGGTCGGG Locus tag: SGR_3746 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	SGR_3746	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -77 Score: 5 Sequence: ATCGACCGAATGATCGGTCGCC Locus tag: SGR_6814 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	SGR_6814	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -34 Score: 6.1 Sequence: AGGAACCGAACGATCGGTCGGT Locus tag: SGR_3741 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: SGR_3740 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: SGR_3739 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: SGR_3738 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: SGR_3737 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	SGR_3741	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	SGR_3740	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	SGR_3739	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	SGR_3738	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	SGR_3737	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Position: -127 Score: 5.6 Sequence: CGCGACCGAACAATCGGTAGGT Locus tag: SGR_3748 Name: bkdA Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) Locus tag: SGR_3749 Name: bkdB Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) Locus tag: SGR_3750 Name: bkdC Funciton: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
	SGR_3748	bkdA	Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
	SGR_3749	bkdB	Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
	SGR_3750	bkdC	Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
Position: -72 Score: 5.2 Sequence: CCCGACCGATCGTTCGGTTACT Locus tag: SGR_3745 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	SGR_3745	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD