Regulon of PaaR in Rhodococcus opacus B4

Properties
Regulator type:	Transcription factor
TF locus tag:	ROP_23860
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Actinobacteria
Statistics of regulated genes:
- Genes	15
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -80 Score: 4.6 Sequence: CTGAACCGAACCTTCGGTCGGC Locus tag: ROP_23860 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	ROP_23860	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -127 Score: 5.6 Sequence: AATAACCGAATCTTCGGTCGGT Position: -32 Score: 5.1 Sequence: ACCGACCGAACGTACGGTGAAA Locus tag: ROP_25870 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: ROP_25880 Name: ethD Funciton: Possible ethyl tert-butyl ether degradation protein EthD Locus tag: ROP_25890 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase
	ROP_25870	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	ROP_25880	ethD	Possible ethyl tert-butyl ether degradation protein EthD
	ROP_25890	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
Position: 23 Score: 5 Sequence: ACCAACCGATCATTCGGTAATA Locus tag: ROP_25820 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: ROP_25810 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: ROP_25800 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: ROP_25790 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: ROP_25780 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: ROP_25770 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	ROP_25820	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	ROP_25810	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	ROP_25800	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	ROP_25790	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	ROP_25780	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	ROP_25770	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -148 Score: 5.1 Sequence: TTTCACCGTACGTTCGGTCGGT Position: -53 Score: 5.3 Sequence: ACCGACCGAAGATTCGGTTATT Locus tag: ROP_25860 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: ROP_25850 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: ROP_25840 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: ROP_25830 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	ROP_25860	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	ROP_25850	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	ROP_25840	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	ROP_25830	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -122 Score: 5.5 Sequence: ACCAACCGAACGTACGGTTATA Position: -39 Score: 5.4 Sequence: CCTGACCGAACAATCGGTCGAG Locus tag: ROP_17540 Name: paaT Funciton: Predicted phylacetic acid transporter PaaT
	ROP_17540	paaT	Predicted phylacetic acid transporter PaaT

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PaaR in Rhodococcus opacus B4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --