Regulog MntR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | 1 | 1 |
| Lactococcus lactis subsp. lactis Il1403 | 4 | 2 |
| Streptococcus agalactiae 2603V/R | 10 | 4 |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | 5 | 3 |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | 9 | 3 |
| Streptococcus gallolyticus UCN34 | 4 | 2 |
| Streptococcus gordonii str. Challis substr. CH1 | 3 | 1 |
| Streptococcus mitis B6 | 5 | 3 |
| Streptococcus mutans UA159 | 3 | 1 |
| Streptococcus pneumoniae TIGR4 | 4 | 2 |
| Streptococcus pyogenes M1 GAS | 5 | 3 |
| Streptococcus sanguinis SK36 | 3 | 1 |
| Streptococcus suis 05ZYH33 | 2 | 2 |
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J | 6 | 4 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| SPy1434 |
|
|
|
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -54 score = 5.02662 sequence = ATAATTAATATATCTTAAAGAT Gene: SDEG_1473: Predicted cation transporting ATPase (EC 3.6.3.3) |
|
|
|
|
Gene: SMU.2057c: Predicted cation transporting ATPase (EC 3.6.3.3) |
|
*
Streptococcus pyogenes M1 GAS Site: position = -86 score = 5.10521 sequence = CTAAATTACTTGACTTATTTAT Site: position = -53 score = 5.02662 sequence = ATAATTAATATATCTTAAAGAT Gene: SPy1434: Predicted cation transporting ATPase (EC 3.6.3.3) |
|
*
Streptococcus suis 05ZYH33 Site: position = -135 score = 5.35356 sequence = ATAAATAACTTGACTTTCTTTT Site: position = -103 score = 5.27973 sequence = ATAATTAACTTAGTTAAATGAT Gene: SSU05_0309: Predicted cation transporting ATPase (EC 3.6.3.3) |
|
*
Streptococcus uberis 0140J Site: position = -54 score = 5.34384 sequence = ATAATTAAGATGAATTAAATTG Gene: SUB1266: Predicted cation transporting ATPase (EC 3.6.3.3) |
Predicted cation transporting ATPase (EC 3.6.3.3) |
| CRON 2. | ||||||||||||||||
| mntR |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -31 score = 5.12554 sequence = ATAATTAAATGGAGAAAAGTAA Gene: LACR_1369: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -31 score = 5.09735 sequence = ATAATTAAATCAAGAAAAGTAA Gene: L84767: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Streptococcus agalactiae 2603V/R Site: position = -151 score = 5.05341 sequence = AAAATTAATATAAGTTATGTAT Site: position = -129 score = 6.20842 sequence = TAAATTAAGTTAACTTAATTTT Gene: SAG1534: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -116 score = 5.97345 sequence = TTAATTAAGTATAGTTAAATAT Gene: SDEG_0487: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -116 score = 6.20754 sequence = TTAATTAAGTATAGTTAATTAT Gene: Sez_1470: Manganese homeostasis transcriptional regulator MntR, DtxR family |
Gene: GALLO_1718: Manganese homeostasis transcriptional regulator MntR, DtxR family |
Gene: SGO_1816: Manganese homeostasis transcriptional regulator MntR, DtxR family |
Gene: smi_0645: Manganese homeostasis transcriptional regulator MntR, DtxR family |
Gene: SMU.186: Manganese homeostasis transcriptional regulator MntR, DtxR family |
Gene: SP_1638: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Streptococcus pyogenes M1 GAS Site: position = -116 score = 6.25894 sequence = TTAATTAAGTTTAGTTAATTAT Gene: SPy0450: Manganese homeostasis transcriptional regulator MntR, DtxR family |
Gene: SSA_0256: Manganese homeostasis transcriptional regulator MntR, DtxR family |
Gene: SSU05_2087: Manganese homeostasis transcriptional regulator MntR, DtxR family |
|
*
Streptococcus uberis 0140J Site: position = -117 score = 5.9289 sequence = TTAATTAAGTATGGTTAATTAT Gene: SUBp03: Manganese homeostasis transcriptional regulator MntR, DtxR family |
Manganese homeostasis transcriptional regulator MntR, DtxR family |
| CRON 3. | ||||||||||||||||
| nikA |
|
|
*
Streptococcus agalactiae 2603V/R Site: position = -56 score = 5.18199 sequence = CTAATTAAGTTTGCTTAAAAAA Site: position = -34 score = 5.21345 sequence = ATAATTAACTAAACTTAAAAGA Gene: SAG1518: Nickel ABC transporter, substrate-binding protein |
|
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -79 score = 5.91236 sequence = TAAATTAACCATACTTAATTTT Gene: Sez_1456: Nickel ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
Nickel ABC transporter, substrate-binding protein |
| nikB |
|
|
Gene: SAG1517: Nickel ABC transporter, permease protein 1 |
|
Gene: Sez_1455: Nickel ABC transporter, permease protein 1 |
|
|
|
|
|
|
|
|
|
|
Nickel ABC transporter, permease protein 1 |
| nikC |
|
|
Gene: SAG1516: Nickel ABC transporter, permease protein 2 |
|
Gene: Sez_1454: Nickel ABC transporter, permease protein 2 |
|
|
|
|
|
|
|
|
|
|
Nickel ABC transporter, permease protein 2 |
| nikD |
|
|
Gene: SAG1515: Nickel ABC transporter, ATP-binding protein 1 |
|
Gene: Sez_1453: Nickel ABC transporter, ATP-binding protein 1 |
|
|
|
|
|
|
|
|
|
|
Nickel ABC transporter, ATP-binding protein 1 |
| nikE |
|
|
Gene: SAG1514: Nickel ABC transporter, ATP-binding protein 2 |
|
Gene: Sez_1452: Nickel ABC transporter, ATP-binding protein 2 |
|
|
|
|
|
|
|
|
|
|
Nickel ABC transporter, ATP-binding protein 2 |
| CRON 4. | ||||||||||||||||
| mntH |
|
|
*
Streptococcus agalactiae 2603V/R Site: position = -85 score = 5.53946 sequence = ATTATTAAGTAGCGTTAATTTT Gene: SAG0745: Manganese transport protein MntH |
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -78 score = 5.2153 sequence = TTAATTAAATACGCTTTATTTT Gene: GALLO_0590: Manganese transport protein MntH |
Gene: SGO_0217: Manganese transport protein MntH |
*
Streptococcus mitis B6 Site: position = -164 score = 5.20338 sequence = AAAATTAACCAATATTAATAAT Gene: smi_1232: Manganese transport protein MntH |
Gene: SMU.770c: Manganese transport protein MntH |
|
|
|
|
Gene: str0677: Manganese transport protein MntH |
|
Manganese transport protein MntH |
| CRON 5. | ||||||||||||||||
| mntB |
Gene: LACR_1440: Manganese ABC transporter, ATP-binding protein |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -87 score = 4.90626 sequence = CAAAATATATTGATTTAATTTT Gene: L150744: Manganese ABC transporter, ATP-binding protein |
Gene: SAG1532: Manganese ABC transporter, ATP-binding protein |
Gene: SDEG_0489: Manganese ABC transporter, ATP-binding protein |
Gene: Sez_1468: Manganese ABC transporter, ATP-binding protein |
Gene: GALLO_2046: Manganese ABC transporter, ATP-binding protein |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -60 score = 6.43283 sequence = AAAATTAACTTGACTTAATTTT Gene: SGO_1800: Manganese ABC transporter, ATP-binding protein |
*
Streptococcus mitis B6 Site: position = -62 score = 6.07966 sequence = AAAATTAACTTGACTTAACTTT Gene: smi_0636: Manganese ABC transporter, ATP-binding protein |
*
Streptococcus mutans UA159 Site: position = -57 score = 6.43283 sequence = AAAATTAACTTGACTTAATTTT Gene: SMU.182: Manganese ABC transporter, ATP-binding protein |
*
Streptococcus pneumoniae TIGR4 Site: position = -62 score = 6.43283 sequence = AAAATTAACTTGACTTAATTTT Gene: SP_1648: Manganese ABC transporter, ATP-binding protein |
Gene: SPy0454: Manganese ABC transporter, ATP-binding protein |
*
Streptococcus sanguinis SK36 Site: position = -29 score = 6.43283 sequence = AAAATTAACTTGACTTAATTTT Gene: SSA_0262: Manganese ABC transporter, ATP-binding protein |
|
|
Gene: SUB0474: Manganese ABC transporter, ATP-binding protein |
Manganese ABC transporter, ATP-binding protein |
| mntC |
Gene: LACR_1439: Manganese ABC transporter, permease protein |
Gene: L149891: Manganese ABC transporter, permease protein |
Gene: SAG1531: Manganese ABC transporter, permease protein |
Gene: SDEG_0490: Manganese ABC transporter, permease protein |
Gene: Sez_1467: Manganese ABC transporter, permease protein |
Gene: GALLO_2045: Manganese ABC transporter, permease protein |
Gene: SGO_1801: Manganese ABC transporter, permease protein |
Gene: smi_0635: Manganese ABC transporter, permease protein |
Gene: SMU.183: Manganese ABC transporter, permease protein |
Gene: SP_1649: Manganese ABC transporter, permease protein |
Gene: SPy0456: Manganese ABC transporter, permease protein |
Gene: SSA_0261: Manganese ABC transporter, permease protein |
|
|
Gene: SUB0475: Manganese ABC transporter, permease protein |
Manganese ABC transporter, permease protein |
| mntA |
|
Gene: L148957: Manganese ABC transporter, substrate-binding protein |
*
Streptococcus agalactiae 2603V/R Site: position = -59 score = 6.26389 sequence = AAAATTAAGTTAACTTAATTTA Gene: SAG1533: Manganese ABC transporter, substrate-binding protein |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -51 score = 6.07104 sequence = ATATTTAACTATACTTAATTAA Gene: SDEG_0488: Manganese ABC transporter, substrate-binding protein |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -51 score = 6.3792 sequence = ATAATTAACTATACTTAATTAA Gene: Sez_1469: Manganese ABC transporter, substrate-binding protein |
*
Streptococcus gallolyticus UCN34 Site: position = -53 score = 5.78171 sequence = AAAATTAAGCATGCTTAATTTT Gene: GALLO_2047: Manganese ABC transporter, substrate-binding protein |
Gene: SGO_1802: Manganese ABC transporter, substrate-binding protein |
Gene: smi_0634: Manganese ABC transporter, substrate-binding protein |
Gene: SMU.184: Manganese ABC transporter, substrate-binding protein |
Gene: SP_1650: Manganese ABC transporter, substrate-binding protein |
*
Streptococcus pyogenes M1 GAS Site: position = -51 score = 6.35101 sequence = ATAATTAACTAAACTTAATTAA Gene: SPy0453: Manganese ABC transporter, substrate-binding protein |
Gene: SSA_0260: Manganese ABC transporter, substrate-binding protein |
|
|
*
Streptococcus uberis 0140J Site: position = -32 score = 4.90236 sequence = TTAATTATATAATATAAATTAA Site: position = -50 score = 6.08223 sequence = ATAATTAACCATACTTAATTAA Gene: SUB0473: Manganese ABC transporter, substrate-binding protein |
Manganese ABC transporter, substrate-binding protein |
| CRON 6. | ||||||||||||||||
| prtA |
|
|
|
|
|
|
|
*
Streptococcus mitis B6 Site: position = -194 score = 5.6468 sequence = AAAATTAACCAGCCTTAATTTT Gene: smi_0705: C5a peptidase precursor (EC 3.4.21.-) |
|
*
Streptococcus pneumoniae TIGR4 Site: position = -194 score = 5.84153 sequence = TAAATTAACTAATGTTAATTTT Gene: SP_0641: C5a peptidase precursor (EC 3.4.21.-) |
|
|
*
Streptococcus suis 05ZYH33 Site: position = -32 score = 5.14573 sequence = TAAATTAATTAAACTTAAAAAA Gene: SSU05_1982: C5a peptidase precursor (EC 3.4.21.-) |
|
*
Streptococcus uberis 0140J Site: position = -83 score = 5.65866 sequence = ATTATTAAGTATACTTAATAAT Gene: SUB0826: C5a peptidase precursor (EC 3.4.21.-) |
C5a peptidase precursor (EC 3.4.21.-) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |