Regulon of MntR in Streptococcus gallolyticus UCN34

Properties
Regulator type:	Transcription factor
TF locus tag:	GALLO_1718
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -78 Score: 5.2 Sequence: TTAATTAAATACGCTTTATTTT Locus tag: GALLO_0590 Name: mntH Funciton: Manganese transport protein MntH
	GALLO_0590	mntH	Manganese transport protein MntH
Position: -53 Score: 5.8 Sequence: AAAATTAAGCATGCTTAATTTT Locus tag: GALLO_2047 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: GALLO_2046 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: GALLO_2045 Name: mntC Funciton: Manganese ABC transporter, permease protein
	GALLO_2047	mntA	Manganese ABC transporter, substrate-binding protein
	GALLO_2046	mntB	Manganese ABC transporter, ATP-binding protein
	GALLO_2045	mntC	Manganese ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD