Regulon of MntR in Streptococcus pneumoniae TIGR4

Properties
Regulator type:	Transcription factor
TF locus tag:	SP_1638
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -194 Score: 5.8 Sequence: TAAATTAACTAATGTTAATTTT Locus tag: SP_0641 Name: prtA Funciton: C5a peptidase precursor (EC 3.4.21.-)
	SP_0641	prtA	C5a peptidase precursor (EC 3.4.21.-)
Position: -62 Score: 6.4 Sequence: AAAATTAACTTGACTTAATTTT Locus tag: SP_1648 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: SP_1649 Name: mntC Funciton: Manganese ABC transporter, permease protein Locus tag: SP_1650 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
	SP_1648	mntB	Manganese ABC transporter, ATP-binding protein
	SP_1649	mntC	Manganese ABC transporter, permease protein
	SP_1650	mntA	Manganese ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD