Regulon of MntR in Streptococcus dysgalactiae subsp. equisimilis GGS_124

Properties
Regulator type:	Transcription factor
TF locus tag:	SDEG_0487
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 5 Sequence: ATAATTAATATATCTTAAAGAT Locus tag: SDEG_1473 Name: SPy1434 Funciton: Predicted cation transporting ATPase (EC 3.6.3.3)
	SDEG_1473	SPy1434	Predicted cation transporting ATPase (EC 3.6.3.3)
Position: -116 Score: 6 Sequence: TTAATTAAGTATAGTTAAATAT Locus tag: SDEG_0487 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
	SDEG_0487	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
Position: -51 Score: 6.1 Sequence: ATATTTAACTATACTTAATTAA Locus tag: SDEG_0488 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: SDEG_0489 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: SDEG_0490 Name: mntC Funciton: Manganese ABC transporter, permease protein
	SDEG_0488	mntA	Manganese ABC transporter, substrate-binding protein
	SDEG_0489	mntB	Manganese ABC transporter, ATP-binding protein
	SDEG_0490	mntC	Manganese ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD