Regulon of MntR in Streptococcus mitis B6

Properties
Regulator type:	Transcription factor
TF locus tag:	smi_0645
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -164 Score: 5.2 Sequence: AAAATTAACCAATATTAATAAT Locus tag: smi_1232 Name: mntH Funciton: Manganese transport protein MntH
	smi_1232	mntH	Manganese transport protein MntH
Position: -194 Score: 5.6 Sequence: AAAATTAACCAGCCTTAATTTT Locus tag: smi_0705 Name: prtA Funciton: C5a peptidase precursor (EC 3.4.21.-)
	smi_0705	prtA	C5a peptidase precursor (EC 3.4.21.-)
Position: -62 Score: 6.1 Sequence: AAAATTAACTTGACTTAACTTT Locus tag: smi_0636 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: smi_0635 Name: mntC Funciton: Manganese ABC transporter, permease protein Locus tag: smi_0634 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
	smi_0636	mntB	Manganese ABC transporter, ATP-binding protein
	smi_0635	mntC	Manganese ABC transporter, permease protein
	smi_0634	mntA	Manganese ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD