Regulon of MntR in Streptococcus mutans UA159

Properties
Regulator type:	Transcription factor
TF locus tag:	SMU.186
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 6.4 Sequence: AAAATTAACTTGACTTAATTTT Locus tag: SMU.182 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: SMU.183 Name: mntC Funciton: Manganese ABC transporter, permease protein Locus tag: SMU.184 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
	SMU.182	mntB	Manganese ABC transporter, ATP-binding protein
	SMU.183	mntC	Manganese ABC transporter, permease protein
	SMU.184	mntA	Manganese ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD