Regulon of MntR in Streptococcus uberis 0140J

Properties
Regulator type:	Transcription factor
TF locus tag:	SUBp03
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 5.7 Sequence: ATTATTAAGTATACTTAATAAT Locus tag: SUB0826 Name: prtA Funciton: C5a peptidase precursor (EC 3.4.21.-)
	SUB0826	prtA	C5a peptidase precursor (EC 3.4.21.-)
Position: -54 Score: 5.3 Sequence: ATAATTAAGATGAATTAAATTG Locus tag: SUB1266 Name: SPy1434 Funciton: Predicted cation transporting ATPase (EC 3.6.3.3)
	SUB1266	SPy1434	Predicted cation transporting ATPase (EC 3.6.3.3)
Position: -117 Score: 5.9 Sequence: TTAATTAAGTATGGTTAATTAT Locus tag: SUBp03 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
	SUBp03	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
Position: -50 Score: 6.1 Sequence: ATAATTAACCATACTTAATTAA Position: -32 Score: 4.9 Sequence: TTAATTATATAATATAAATTAA Locus tag: SUB0473 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: SUB0474 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: SUB0475 Name: mntC Funciton: Manganese ABC transporter, permease protein
	SUB0473	mntA	Manganese ABC transporter, substrate-binding protein
	SUB0474	mntB	Manganese ABC transporter, ATP-binding protein
	SUB0475	mntC	Manganese ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD