Regulon of MntR in Streptococcus agalactiae 2603V/R

Properties
Regulator type:	Transcription factor
TF locus tag:	SAG1534
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Streptococcaceae
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 5.2 Sequence: CTAATTAAGTTTGCTTAAAAAA Position: -34 Score: 5.2 Sequence: ATAATTAACTAAACTTAAAAGA Locus tag: SAG1518 Name: nikA Funciton: Nickel ABC transporter, substrate-binding protein Locus tag: SAG1517 Name: nikB Funciton: Nickel ABC transporter, permease protein 1 Locus tag: SAG1516 Name: nikC Funciton: Nickel ABC transporter, permease protein 2 Locus tag: SAG1515 Name: nikD Funciton: Nickel ABC transporter, ATP-binding protein 1 Locus tag: SAG1514 Name: nikE Funciton: Nickel ABC transporter, ATP-binding protein 2
	SAG1518	nikA	Nickel ABC transporter, substrate-binding protein
	SAG1517	nikB	Nickel ABC transporter, permease protein 1
	SAG1516	nikC	Nickel ABC transporter, permease protein 2
	SAG1515	nikD	Nickel ABC transporter, ATP-binding protein 1
	SAG1514	nikE	Nickel ABC transporter, ATP-binding protein 2
Position: -85 Score: 5.5 Sequence: ATTATTAAGTAGCGTTAATTTT Locus tag: SAG0745 Name: mntH Funciton: Manganese transport protein MntH
	SAG0745	mntH	Manganese transport protein MntH
Position: -151 Score: 5.1 Sequence: AAAATTAATATAAGTTATGTAT Position: -129 Score: 6.2 Sequence: TAAATTAAGTTAACTTAATTTT Locus tag: SAG1534 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
	SAG1534	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
Position: -59 Score: 6.3 Sequence: AAAATTAAGTTAACTTAATTTA Locus tag: SAG1533 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: SAG1532 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: SAG1531 Name: mntC Funciton: Manganese ABC transporter, permease protein
	SAG1533	mntA	Manganese ABC transporter, substrate-binding protein
	SAG1532	mntB	Manganese ABC transporter, ATP-binding protein
	SAG1531	mntC	Manganese ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD