Regulon of MntR in Streptococcus sanguinis SK36

Properties
Regulator type:	Transcription factor
TF locus tag:	SSA_0256
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 6.4 Sequence: AAAATTAACTTGACTTAATTTT Locus tag: SSA_0262 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: SSA_0261 Name: mntC Funciton: Manganese ABC transporter, permease protein Locus tag: SSA_0260 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
	SSA_0262	mntB	Manganese ABC transporter, ATP-binding protein
	SSA_0261	mntC	Manganese ABC transporter, permease protein
	SSA_0260	mntA	Manganese ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD