Regulon of MntR in Streptococcus suis 05ZYH33

Properties
Regulator type:	Transcription factor
TF locus tag:	SSU05_2087
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Streptococcaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -135 Score: 5.4 Sequence: ATAAATAACTTGACTTTCTTTT Position: -103 Score: 5.3 Sequence: ATAATTAACTTAGTTAAATGAT Locus tag: SSU05_0309 Name: SPy1434 Funciton: Predicted cation transporting ATPase (EC 3.6.3.3)
	SSU05_0309	SPy1434	Predicted cation transporting ATPase (EC 3.6.3.3)
Position: -32 Score: 5.1 Sequence: TAAATTAATTAAACTTAAAAAA Locus tag: SSU05_1982 Name: prtA Funciton: C5a peptidase precursor (EC 3.4.21.-)
	SSU05_1982	prtA	C5a peptidase precursor (EC 3.4.21.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD