Regulog PhnR - Vibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - PhnR
By taxonomy - Vibrionales
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Statistics of regulated genes
Genome	Genes	Operons
Vibrio cholerae O1 biovar eltor str. N16961	8	3
Vibrio vulnificus CMCP6	9	3
Vibrio harveyi ATCC BAA-1116	8	3
Vibrio parahaemolyticus RIMD 2210633	15	5
Vibrio shilonii AK1	14	5
Vibrio splendidus LGP32	9	3
Vibrio fischeri ES114	6	1
Vibrio salmonicida LFI1238	11	4
Vibrio angustum S14	8	4
Photobacterium profundum SS9

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
phnW	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -28 score = 5.19134 sequence = TTATTGGTATAGTCCAAAAA Site: position = -224 score = 5.68824 sequence = AATTTGGTATGTACCAGAAT Gene: VCA0604: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)	* Vibrio vulnificus CMCP6 Site: position = -228 score = 5.3663 sequence = ATTTTGGTCTGTACCAGTTG Site: position = -30 score = 5.03519 sequence = TTTCTGGTGTAGACCAATTA Gene: VV21664: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)	* Vibrio harveyi ATCC BAA-1116 Site: position = -139 score = 5.43841 sequence = AATTTGGTCTGTACCAGTTG Site: position = 57 score = 5.65187 sequence = AATTTGGTATATACCAACAA Gene: VIBHAR_04876: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -42 score = 5.03519 sequence = TTTCTGGTGTAGACCAATTA Site: position = -240 score = 5.3663 sequence = ATTTTGGTCTGTACCAGTTG Gene: VPA0235: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)	* Vibrio shilonii AK1 Site: position = -209 score = 5.0159 sequence = GATTTGGTCTGTACCAGTTT Site: position = -30 score = 5.52055 sequence = AAATTGGTATAGTCCAAATA Gene: VSAK1_17767: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)	* Vibrio splendidus LGP32 Site: position = -34 score = 5.37675 sequence = ATACTGGTATAGTCCAAAAT Site: position = -222 score = 5.25171 sequence = ACATTGGTATGTACCAGATG Gene: VS_II0398: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)	Vibrio fischeri ES114	* Vibrio salmonicida LFI1238 Site: position = -18 score = 5.57484 sequence = AAACTGATATATACCAAAAT Site: position = -205 score = 5.43822 sequence = AAATTGGTATGTACCATTAA Gene: VSAL_II0812: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)	* Vibrio angustum S14 Site: position = -30 score = 5.43841 sequence = AAACTGGTATAGTCCAAATG Site: position = -231 score = 5.65573 sequence = ATTTTGGTATGTACCAGTTT Gene: VAS14_11014: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)	Photobacterium profundum SS9	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
COG0160	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0605: 4-aminobutyrate aminotransferase and related aminotransferases	Vibrio vulnificus CMCP6 Gene: VV21663: 4-aminobutyrate aminotransferase and related aminotransferases	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_04875: 4-aminobutyrate aminotransferase and related aminotransferases	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0234: 4-aminobutyrate aminotransferase and related aminotransferases	Vibrio shilonii AK1 Gene: VSAK1_17772: 4-aminobutyrate aminotransferase and related aminotransferases	Vibrio splendidus LGP32 Gene: VS_II0397: 4-aminobutyrate aminotransferase and related aminotransferases	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: VSAL_II0813: 4-aminobutyrate aminotransferase and related aminotransferases	Vibrio angustum S14 Gene: VAS14_11019: 4-aminobutyrate aminotransferase and related aminotransferases	Photobacterium profundum SS9	4-aminobutyrate aminotransferase and related aminotransferases
phnX	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0606: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)	Vibrio vulnificus CMCP6 Gene: VV21662: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_04874: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0233: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)	Vibrio shilonii AK1 Gene: VSAK1_17777: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)	Vibrio splendidus LGP32 Gene: VS_II0396: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: VSAL_II0814: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)	Vibrio angustum S14 Gene: VAS14_11024: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)	Photobacterium profundum SS9	2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)

CRON 2.
phnT	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 6 score = 5.66595 sequence = ATTTTGGACTATACCAAATT Gene: VCA0602: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	* Vibrio vulnificus CMCP6 Site: position = -31 score = 5.90404 sequence = AATTTGGTATATACCATTTG Gene: VV21669: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	* Vibrio harveyi ATCC BAA-1116 Site: position = -31 score = 5.60933 sequence = AAGTTGGTATATACCATTTG Gene: VIBHAR_04880: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -31 score = 5.60933 sequence = AAGTTGGTATATACCATTTG Gene: VPA0238: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	* Vibrio shilonii AK1 Site: position = -31 score = 5.90404 sequence = AATTTGGTATATACCATTTG Site: position = -53 score = 4.72749 sequence = CCAATGAAATATACCAGATT Gene: VSAK1_17757: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	* Vibrio splendidus LGP32 Site: position = -34 score = 5.4677 sequence = AATTTGGTATATACCATGTA Gene: VS_II0401: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	Vibrio fischeri ES114	* Vibrio salmonicida LFI1238 Site: position = -31 score = 5.37495 sequence = TATTTGGAGTATACCAAATG Gene: VSAL_II0810: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	* Vibrio angustum S14 Site: position = -35 score = 5.98618 sequence = AATTTGGTATATACCAATTA Gene: VAS14_10979: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	Photobacterium profundum SS9	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
phnU	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0601: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.	Vibrio vulnificus CMCP6 Gene: VV21670: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_04881: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0239: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.	Vibrio shilonii AK1 Gene: VSAK1_17752: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.	Vibrio splendidus LGP32 Gene: VS_II0402: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_10974: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.	Photobacterium profundum SS9	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
phnR	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0600: 2-aminoethylphosphonate utilization regulator, GntR family	Vibrio vulnificus CMCP6 Gene: VV21671: 2-aminoethylphosphonate utilization regulator, GntR family	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_04882: 2-aminoethylphosphonate utilization regulator, GntR family	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0240: 2-aminoethylphosphonate utilization regulator, GntR family	Vibrio shilonii AK1 Gene: VSAK1_17747: 2-aminoethylphosphonate utilization regulator, GntR family	Vibrio splendidus LGP32 Gene: VS_II0403: 2-aminoethylphosphonate utilization regulator, GntR family	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_10969: 2-aminoethylphosphonate utilization regulator, GntR family	Photobacterium profundum SS9	2-aminoethylphosphonate utilization regulator, GntR family
VCA0599	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0599: Permease of the drug/metabolite transporter (DMT) superfamily	Vibrio vulnificus CMCP6 Gene: VV21672: Permease of the drug/metabolite transporter (DMT) superfamily	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_04883: Permease of the drug/metabolite transporter (DMT) superfamily	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0241: Permease of the drug/metabolite transporter (DMT) superfamily	Vibrio shilonii AK1 Gene: VSAK1_17742: Permease of the drug/metabolite transporter (DMT) superfamily	Vibrio splendidus LGP32 Gene: VS_II0404: Permease of the drug/metabolite transporter (DMT) superfamily	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Permease of the drug/metabolite transporter (DMT) superfamily
VV21673	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV21673: Glycine/D-amino acid oxidase	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_04889: Glycine/D-amino acid oxidase	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0244: Glycine/D-amino acid oxidase	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0400: Glycine/D-amino acid oxidase	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -35 score = 4.95887 sequence = TTAGTGGTCTATACCAATTA Gene: VAS14_11029: Glycine/D-amino acid oxidase	Photobacterium profundum SS9	Glycine/D-amino acid oxidase
phnS	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -27 score = 5.68824 sequence = ATTCTGGTACATACCAAATT Site: position = -223 score = 5.19134 sequence = TTTTTGGACTATACCAATAA Gene: VCA0603: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	* Vibrio vulnificus CMCP6 Site: position = -48 score = 5.3663 sequence = CAACTGGTACAGACCAAAAT Site: position = -246 score = 5.03519 sequence = TAATTGGTCTACACCAGAAA Gene: VV21665: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	* Vibrio harveyi ATCC BAA-1116 Site: position = -47 score = 5.43841 sequence = CAACTGGTACAGACCAAATT Site: position = -243 score = 5.65187 sequence = TTGTTGGTATATACCAAATT Gene: VIBHAR_04877: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -246 score = 5.03519 sequence = TAATTGGTCTACACCAGAAA Site: position = -48 score = 5.3663 sequence = CAACTGGTACAGACCAAAAT Gene: VPA0236: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	* Vibrio shilonii AK1 Site: position = -35 score = 5.0159 sequence = AAACTGGTACAGACCAAATC Site: position = -214 score = 5.52055 sequence = TATTTGGACTATACCAATTT Gene: VSAK1_17762: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	* Vibrio splendidus LGP32 Site: position = -380 score = 5.37675 sequence = ATTTTGGACTATACCAGTAT Site: position = -192 score = 5.25171 sequence = CATCTGGTACATACCAATGT Gene: VS_II0399: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	Vibrio fischeri ES114	* Vibrio salmonicida LFI1238 Site: position = 15 score = 5.43822 sequence = TTAATGGTACATACCAATTT Site: position = -172 score = 5.57484 sequence = ATTTTGGTATATATCAGTTT Gene: VSAL_II0811: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	* Vibrio angustum S14 Site: position = -62 score = 5.65573 sequence = AAACTGGTACATACCAAAAT Gene: VAS14_11009: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	Photobacterium profundum SS9	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)

CRON 3.
phnS2	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -211 score = 4.16886 sequence = ATTCTGACCTAGTCCAATAG Site: position = -30 score = 3.79928 sequence = TTACTGACCTAGTCCAGAAG Gene: VPA0354: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	* Vibrio shilonii AK1 Site: position = -30 score = 3.47781 sequence = TTACTGACCTAGTCCAGAGG Gene: VSAK1_19529: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	Vibrio splendidus LGP32	* Vibrio fischeri ES114 Site: position = -31 score = 4.65171 sequence = TTATTGATGTAGTCCAAAAG Gene: VF_A1087: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	* Vibrio salmonicida LFI1238 Site: position = -31 score = 4.65171 sequence = TTATTGATGTAGTCCAAAAG Gene: VSAL_II1027: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB0175: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
PF01663	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0353: type I phosphodiesterase	Vibrio shilonii AK1 Gene: VSAK1_19524: type I phosphodiesterase	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A1088: type I phosphodiesterase	Vibrio salmonicida LFI1238 Gene: VSAL_II1028: type I phosphodiesterase	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB0176: type I phosphodiesterase	type I phosphodiesterase
phnU2	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0352: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)	Vibrio shilonii AK1 Gene: VSAK1_19519: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A1089: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)	Vibrio salmonicida LFI1238 Gene: VSAL_II1029: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB0177: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
phnV2	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0351: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)	Vibrio shilonii AK1 Gene: VSAK1_19514: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A1090: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)	Vibrio salmonicida LFI1238 Gene: VSAL_II1030: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB0178: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)	2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
phnT2	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0350: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	Vibrio shilonii AK1 Gene: VSAK1_19509: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A1091: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	Vibrio salmonicida LFI1238 Gene: VSAL_II1031: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB0179: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
COG0560	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0349: Phosphoserine phosphatase (EC 3.1.3.3)	Vibrio shilonii AK1 Gene: VSAK1_19504: Phosphoserine phosphatase (EC 3.1.3.3)	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A1092: Phosphoserine phosphatase (EC 3.1.3.3)	Vibrio salmonicida LFI1238 Gene: VSAL_II1032: Phosphoserine phosphatase (EC 3.1.3.3)	Vibrio angustum S14	Photobacterium profundum SS9	Phosphoserine phosphatase (EC 3.1.3.3)

CRON 4.
phnR2	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -18 score = 3.56252 sequence = CTATTGGACTAGGTCAGAAT Gene: VPA0355: 2-aminoethylphosphonate utilization regulator, GntR family	* Vibrio shilonii AK1 Site: position = -123 score = 3.47781 sequence = CCTCTGGACTAGGTCAGTAA Gene: VSAK1_19534: 2-aminoethylphosphonate utilization regulator, GntR family	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	2-aminoethylphosphonate utilization regulator, GntR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PhnR - Vibrionales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --