Regulog PhnR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization; 2-aminoethylphosphonate utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - PhnR
- By taxonomy - Vibrionales
- By TF family - GntR/Others
- By pathway - Phosphonate utilization
- By pathway - 2-aminoethylphosphonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | 8 | 3 |
| Vibrio vulnificus CMCP6 | 9 | 3 |
| Vibrio harveyi ATCC BAA-1116 | 8 | 3 |
| Vibrio parahaemolyticus RIMD 2210633 | 15 | 5 |
| Vibrio shilonii AK1 | 14 | 5 |
| Vibrio splendidus LGP32 | 9 | 3 |
| Vibrio fischeri ES114 | 6 | 1 |
| Vibrio salmonicida LFI1238 | 11 | 4 |
| Vibrio angustum S14 | 8 | 4 |
| Photobacterium profundum SS9 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| phnW |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -28 score = 5.19134 sequence = TTATTGGTATAGTCCAAAAA Site: position = -224 score = 5.68824 sequence = AATTTGGTATGTACCAGAAT Gene: VCA0604: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
*
Vibrio vulnificus CMCP6 Site: position = -228 score = 5.3663 sequence = ATTTTGGTCTGTACCAGTTG Site: position = -30 score = 5.03519 sequence = TTTCTGGTGTAGACCAATTA Gene: VV21664: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -139 score = 5.43841 sequence = AATTTGGTCTGTACCAGTTG Site: position = 57 score = 5.65187 sequence = AATTTGGTATATACCAACAA Gene: VIBHAR_04876: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -42 score = 5.03519 sequence = TTTCTGGTGTAGACCAATTA Site: position = -240 score = 5.3663 sequence = ATTTTGGTCTGTACCAGTTG Gene: VPA0235: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
*
Vibrio shilonii AK1 Site: position = -209 score = 5.0159 sequence = GATTTGGTCTGTACCAGTTT Site: position = -30 score = 5.52055 sequence = AAATTGGTATAGTCCAAATA Gene: VSAK1_17767: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
*
Vibrio splendidus LGP32 Site: position = -34 score = 5.37675 sequence = ATACTGGTATAGTCCAAAAT Site: position = -222 score = 5.25171 sequence = ACATTGGTATGTACCAGATG Gene: VS_II0398: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
|
*
Vibrio salmonicida LFI1238 Site: position = -18 score = 5.57484 sequence = AAACTGATATATACCAAAAT Site: position = -205 score = 5.43822 sequence = AAATTGGTATGTACCATTAA Gene: VSAL_II0812: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
*
Vibrio angustum S14 Site: position = -30 score = 5.43841 sequence = AAACTGGTATAGTCCAAATG Site: position = -231 score = 5.65573 sequence = ATTTTGGTATGTACCAGTTT Gene: VAS14_11014: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
|
2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
| COG0160 |
Gene: VCA0605: 4-aminobutyrate aminotransferase and related aminotransferases |
Gene: VV21663: 4-aminobutyrate aminotransferase and related aminotransferases |
Gene: VIBHAR_04875: 4-aminobutyrate aminotransferase and related aminotransferases |
Gene: VPA0234: 4-aminobutyrate aminotransferase and related aminotransferases |
Gene: VSAK1_17772: 4-aminobutyrate aminotransferase and related aminotransferases |
Gene: VS_II0397: 4-aminobutyrate aminotransferase and related aminotransferases |
|
Gene: VSAL_II0813: 4-aminobutyrate aminotransferase and related aminotransferases |
Gene: VAS14_11019: 4-aminobutyrate aminotransferase and related aminotransferases |
|
4-aminobutyrate aminotransferase and related aminotransferases |
| phnX |
Gene: VCA0606: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
Gene: VV21662: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
Gene: VIBHAR_04874: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
Gene: VPA0233: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
Gene: VSAK1_17777: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
Gene: VS_II0396: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
|
Gene: VSAL_II0814: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
Gene: VAS14_11024: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
|
2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
| CRON 2. | |||||||||||
| phnT |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 6 score = 5.66595 sequence = ATTTTGGACTATACCAAATT Gene: VCA0602: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
*
Vibrio vulnificus CMCP6 Site: position = -31 score = 5.90404 sequence = AATTTGGTATATACCATTTG Gene: VV21669: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -31 score = 5.60933 sequence = AAGTTGGTATATACCATTTG Gene: VIBHAR_04880: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -31 score = 5.60933 sequence = AAGTTGGTATATACCATTTG Gene: VPA0238: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
*
Vibrio shilonii AK1 Site: position = -31 score = 5.90404 sequence = AATTTGGTATATACCATTTG Site: position = -53 score = 4.72749 sequence = CCAATGAAATATACCAGATT Gene: VSAK1_17757: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
*
Vibrio splendidus LGP32 Site: position = -34 score = 5.4677 sequence = AATTTGGTATATACCATGTA Gene: VS_II0401: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
|
*
Vibrio salmonicida LFI1238 Site: position = -31 score = 5.37495 sequence = TATTTGGAGTATACCAAATG Gene: VSAL_II0810: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
*
Vibrio angustum S14 Site: position = -35 score = 5.98618 sequence = AATTTGGTATATACCAATTA Gene: VAS14_10979: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
|
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
| phnU |
Gene: VCA0601: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. |
Gene: VV21670: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. |
Gene: VIBHAR_04881: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. |
Gene: VPA0239: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. |
Gene: VSAK1_17752: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. |
Gene: VS_II0402: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. |
|
|
Gene: VAS14_10974: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. |
|
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. |
| phnR |
Gene: VCA0600: 2-aminoethylphosphonate utilization regulator, GntR family |
Gene: VV21671: 2-aminoethylphosphonate utilization regulator, GntR family |
Gene: VIBHAR_04882: 2-aminoethylphosphonate utilization regulator, GntR family |
Gene: VPA0240: 2-aminoethylphosphonate utilization regulator, GntR family |
Gene: VSAK1_17747: 2-aminoethylphosphonate utilization regulator, GntR family |
Gene: VS_II0403: 2-aminoethylphosphonate utilization regulator, GntR family |
|
|
Gene: VAS14_10969: 2-aminoethylphosphonate utilization regulator, GntR family |
|
2-aminoethylphosphonate utilization regulator, GntR family |
| VCA0599 |
Gene: VCA0599: Permease of the drug/metabolite transporter (DMT) superfamily |
Gene: VV21672: Permease of the drug/metabolite transporter (DMT) superfamily |
Gene: VIBHAR_04883: Permease of the drug/metabolite transporter (DMT) superfamily |
Gene: VPA0241: Permease of the drug/metabolite transporter (DMT) superfamily |
Gene: VSAK1_17742: Permease of the drug/metabolite transporter (DMT) superfamily |
Gene: VS_II0404: Permease of the drug/metabolite transporter (DMT) superfamily |
|
|
|
|
Permease of the drug/metabolite transporter (DMT) superfamily |
| VV21673 |
|
Gene: VV21673: Glycine/D-amino acid oxidase |
Gene: VIBHAR_04889: Glycine/D-amino acid oxidase |
Gene: VPA0244: Glycine/D-amino acid oxidase |
|
Gene: VS_II0400: Glycine/D-amino acid oxidase |
|
|
*
Vibrio angustum S14 Site: position = -35 score = 4.95887 sequence = TTAGTGGTCTATACCAATTA Gene: VAS14_11029: Glycine/D-amino acid oxidase |
|
Glycine/D-amino acid oxidase |
| phnS |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -27 score = 5.68824 sequence = ATTCTGGTACATACCAAATT Site: position = -223 score = 5.19134 sequence = TTTTTGGACTATACCAATAA Gene: VCA0603: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
*
Vibrio vulnificus CMCP6 Site: position = -48 score = 5.3663 sequence = CAACTGGTACAGACCAAAAT Site: position = -246 score = 5.03519 sequence = TAATTGGTCTACACCAGAAA Gene: VV21665: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -47 score = 5.43841 sequence = CAACTGGTACAGACCAAATT Site: position = -243 score = 5.65187 sequence = TTGTTGGTATATACCAAATT Gene: VIBHAR_04877: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -246 score = 5.03519 sequence = TAATTGGTCTACACCAGAAA Site: position = -48 score = 5.3663 sequence = CAACTGGTACAGACCAAAAT Gene: VPA0236: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
*
Vibrio shilonii AK1 Site: position = -35 score = 5.0159 sequence = AAACTGGTACAGACCAAATC Site: position = -214 score = 5.52055 sequence = TATTTGGACTATACCAATTT Gene: VSAK1_17762: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
*
Vibrio splendidus LGP32 Site: position = -380 score = 5.37675 sequence = ATTTTGGACTATACCAGTAT Site: position = -192 score = 5.25171 sequence = CATCTGGTACATACCAATGT Gene: VS_II0399: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
|
*
Vibrio salmonicida LFI1238 Site: position = 15 score = 5.43822 sequence = TTAATGGTACATACCAATTT Site: position = -172 score = 5.57484 sequence = ATTTTGGTATATATCAGTTT Gene: VSAL_II0811: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
*
Vibrio angustum S14 Site: position = -62 score = 5.65573 sequence = AAACTGGTACATACCAAAAT Gene: VAS14_11009: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
|
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
| CRON 3. | |||||||||||
| phnS2 |
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -211 score = 4.16886 sequence = ATTCTGACCTAGTCCAATAG Site: position = -30 score = 3.79928 sequence = TTACTGACCTAGTCCAGAAG Gene: VPA0354: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
*
Vibrio shilonii AK1 Site: position = -30 score = 3.47781 sequence = TTACTGACCTAGTCCAGAGG Gene: VSAK1_19529: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
|
*
Vibrio fischeri ES114 Site: position = -31 score = 4.65171 sequence = TTATTGATGTAGTCCAAAAG Gene: VF_A1087: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
*
Vibrio salmonicida LFI1238 Site: position = -31 score = 4.65171 sequence = TTATTGATGTAGTCCAAAAG Gene: VSAL_II1027: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
|
Gene: PBPRB0175: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
| PF01663 |
|
|
|
Gene: VPA0353: type I phosphodiesterase |
Gene: VSAK1_19524: type I phosphodiesterase |
|
Gene: VF_A1088: type I phosphodiesterase |
Gene: VSAL_II1028: type I phosphodiesterase |
|
Gene: PBPRB0176: type I phosphodiesterase |
type I phosphodiesterase |
| phnU2 |
|
|
|
Gene: VPA0352: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
Gene: VSAK1_19519: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
|
Gene: VF_A1089: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
Gene: VSAL_II1029: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
|
Gene: PBPRB0177: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
| phnV2 |
|
|
|
Gene: VPA0351: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
Gene: VSAK1_19514: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
|
Gene: VF_A1090: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
Gene: VSAL_II1030: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
|
Gene: PBPRB0178: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
| phnT2 |
|
|
|
Gene: VPA0350: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
Gene: VSAK1_19509: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
|
Gene: VF_A1091: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
Gene: VSAL_II1031: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
|
Gene: PBPRB0179: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
| COG0560 |
|
|
|
Gene: VPA0349: Phosphoserine phosphatase (EC 3.1.3.3) |
Gene: VSAK1_19504: Phosphoserine phosphatase (EC 3.1.3.3) |
|
Gene: VF_A1092: Phosphoserine phosphatase (EC 3.1.3.3) |
Gene: VSAL_II1032: Phosphoserine phosphatase (EC 3.1.3.3) |
|
|
Phosphoserine phosphatase (EC 3.1.3.3) |
| CRON 4. | |||||||||||
| phnR2 |
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -18 score = 3.56252 sequence = CTATTGGACTAGGTCAGAAT Gene: VPA0355: 2-aminoethylphosphonate utilization regulator, GntR family |
*
Vibrio shilonii AK1 Site: position = -123 score = 3.47781 sequence = CCTCTGGACTAGGTCAGTAA Gene: VSAK1_19534: 2-aminoethylphosphonate utilization regulator, GntR family |
|
|
|
|
|
2-aminoethylphosphonate utilization regulator, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |