Regulon of PhnR in Vibrio salmonicida LFI1238

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAL_I2059
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Vibrionales
Statistics of regulated genes:
- Genes	11
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - PhnR
By taxonomy - Vibrionales
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 4.7 Sequence: TTATTGATGTAGTCCAAAAG Locus tag: VSAL_II1027 Name: phnS2 Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: VSAL_II1028 Name: PF01663 Funciton: type I phosphodiesterase Locus tag: VSAL_II1029 Name: phnU2 Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) Locus tag: VSAL_II1030 Name: phnV2 Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) Locus tag: VSAL_II1031 Name: phnT2 Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: VSAL_II1032 Name: COG0560 Funciton: Phosphoserine phosphatase (EC 3.1.3.3)
	VSAL_II1027	phnS2	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	VSAL_II1028	PF01663	type I phosphodiesterase
	VSAL_II1029	phnU2	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
	VSAL_II1030	phnV2	2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
	VSAL_II1031	phnT2	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	VSAL_II1032	COG0560	Phosphoserine phosphatase (EC 3.1.3.3)
Position: -31 Score: 5.4 Sequence: TATTTGGAGTATACCAAATG Locus tag: VSAL_II0810 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	VSAL_II0810	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
Position: -172 Score: 5.6 Sequence: ATTTTGGTATATATCAGTTT Position: 15 Score: 5.4 Sequence: TTAATGGTACATACCAATTT Locus tag: VSAL_II0811 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	VSAL_II0811	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Position: -205 Score: 5.4 Sequence: AAATTGGTATGTACCATTAA Position: -18 Score: 5.6 Sequence: AAACTGATATATACCAAAAT Locus tag: VSAL_II0812 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: VSAL_II0813 Name: COG0160 Funciton: 4-aminobutyrate aminotransferase and related aminotransferases Locus tag: VSAL_II0814 Name: phnX Funciton: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	VSAL_II0812	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	VSAL_II0813	COG0160	4-aminobutyrate aminotransferase and related aminotransferases
	VSAL_II0814	phnX	2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD