Regulon of PhnR in Vibrio harveyi ATCC BAA-1116

Properties
Regulator type:	Transcription factor
TF locus tag:	VIBHAR_04882
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Vibrionales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - PhnR
By taxonomy - Vibrionales
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -139 Score: 5.4 Sequence: AATTTGGTCTGTACCAGTTG Position: 57 Score: 5.7 Sequence: AATTTGGTATATACCAACAA Locus tag: VIBHAR_04876 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: VIBHAR_04875 Name: COG0160 Funciton: 4-aminobutyrate aminotransferase and related aminotransferases Locus tag: VIBHAR_04874 Name: phnX Funciton: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	VIBHAR_04876	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	VIBHAR_04875	COG0160	4-aminobutyrate aminotransferase and related aminotransferases
	VIBHAR_04874	phnX	2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
Position: -243 Score: 5.7 Sequence: TTGTTGGTATATACCAAATT Position: -47 Score: 5.4 Sequence: CAACTGGTACAGACCAAATT Locus tag: VIBHAR_04877 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	VIBHAR_04877	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Position: -31 Score: 5.6 Sequence: AAGTTGGTATATACCATTTG Locus tag: VIBHAR_04880 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: VIBHAR_04881 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. Locus tag: VIBHAR_04882 Name: phnR Funciton: 2-aminoethylphosphonate utilization regulator, GntR family Locus tag: VIBHAR_04883 Name: VCA0599 Funciton: Permease of the drug/metabolite transporter (DMT) superfamily
	VIBHAR_04880	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	VIBHAR_04881	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
	VIBHAR_04882	phnR	2-aminoethylphosphonate utilization regulator, GntR family
	VIBHAR_04883	VCA0599	Permease of the drug/metabolite transporter (DMT) superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD