Regulon of PhnR in Vibrio vulnificus CMCP6

Properties
Regulator type:	Transcription factor
TF locus tag:	VV21671
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Vibrionales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - PhnR
By taxonomy - Vibrionales
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -228 Score: 5.4 Sequence: ATTTTGGTCTGTACCAGTTG Position: -30 Score: 5 Sequence: TTTCTGGTGTAGACCAATTA Locus tag: VV21664 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: VV21663 Name: COG0160 Funciton: 4-aminobutyrate aminotransferase and related aminotransferases Locus tag: VV21662 Name: phnX Funciton: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	VV21664	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	VV21663	COG0160	4-aminobutyrate aminotransferase and related aminotransferases
	VV21662	phnX	2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
Position: -31 Score: 5.9 Sequence: AATTTGGTATATACCATTTG Locus tag: VV21669 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: VV21670 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. Locus tag: VV21671 Name: phnR Funciton: 2-aminoethylphosphonate utilization regulator, GntR family Locus tag: VV21672 Name: VCA0599 Funciton: Permease of the drug/metabolite transporter (DMT) superfamily Locus tag: VV21673 Name: null Funciton: Glycine/D-amino acid oxidase
	VV21669	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	VV21670	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
	VV21671	phnR	2-aminoethylphosphonate utilization regulator, GntR family
	VV21672	VCA0599	Permease of the drug/metabolite transporter (DMT) superfamily
	VV21673		Glycine/D-amino acid oxidase
Position: -246 Score: 5 Sequence: TAATTGGTCTACACCAGAAA Position: -48 Score: 5.4 Sequence: CAACTGGTACAGACCAAAAT Locus tag: VV21665 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	VV21665	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD