Regulon of PhnR in Vibrio splendidus LGP32

Properties
Regulator type:	Transcription factor
TF locus tag:	VS_II0403
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Vibrionales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - PhnR
By taxonomy - Vibrionales
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -222 Score: 5.3 Sequence: ACATTGGTATGTACCAGATG Position: -34 Score: 5.4 Sequence: ATACTGGTATAGTCCAAAAT Locus tag: VS_II0398 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: VS_II0397 Name: COG0160 Funciton: 4-aminobutyrate aminotransferase and related aminotransferases Locus tag: VS_II0396 Name: phnX Funciton: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	VS_II0398	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	VS_II0397	COG0160	4-aminobutyrate aminotransferase and related aminotransferases
	VS_II0396	phnX	2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
Position: -34 Score: 5.5 Sequence: AATTTGGTATATACCATGTA Locus tag: VS_II0401 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: VS_II0402 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9. Locus tag: VS_II0403 Name: phnR Funciton: 2-aminoethylphosphonate utilization regulator, GntR family Locus tag: VS_II0404 Name: VCA0599 Funciton: Permease of the drug/metabolite transporter (DMT) superfamily
	VS_II0401	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	VS_II0402	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
	VS_II0403	phnR	2-aminoethylphosphonate utilization regulator, GntR family
	VS_II0404	VCA0599	Permease of the drug/metabolite transporter (DMT) superfamily
Position: -380 Score: 5.4 Sequence: ATTTTGGACTATACCAGTAT Position: -192 Score: 5.3 Sequence: CATCTGGTACATACCAATGT Locus tag: VS_II0399 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: VS_II0400 Name: null Funciton: Glycine/D-amino acid oxidase
	VS_II0399	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	VS_II0400		Glycine/D-amino acid oxidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD